ICEberg
I. Information of ICE
ICEberg ID92
Name Tn1549 This ICE is derived from experimental literature
FamilyUnclassified
OrganismEnterococcus faecalis BM4382
Size (bp)33805
GC content [Genome] (%)52.83
Insertion site-
Function-
Species that ICE can be transferred toEnterococcus faecalis; Enterococcus faecium; Clostridium symbiosum
Nucleotide SequenceAF192329 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..33805 
Putative oriT region coordinates: 22239..22266;   oriTDB id:  200002
GGGAGTGGCTACACTCCCTATGCTTGCT
Putative relaxase coordinates: 20529..21857;   Family:  MOBP


II. ICE interaction with IME/CIME/

The interaction information of Tn1549 is not available.



The graph information of Tn1549 components from AF192329
Complete gene list of Tn1549 from AF192329
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-252..1451 [+], 1200unknown
2-1473..1685 [+], 213unknown
3-1760..2236 [+], 477unknown
4-2233..3927 [+], 1695TrsK-like proteinT4CP 
5-4426..5289 [+], 864unknown
6-5320..5862 [+], 543MunI-like protein
7-5876..6298 [+], 423unknown
8-6228..8627 [+], 2400TrsE-like protein
9-8659..10650 [+], 1992unknownOrf14_Tn, T4SS component 
10-10673..10924 [+], 252unknown
11-10914..12143 [+], 1230bacteriocin-like protein
12-12140..14221 [+], 2082DNA topoisomerase III-like protein
13-14370..18290 [+], 3921LtrC-like protein
14-18291..19235 [+], 945unknown
15-19742..20188 [-], 447unknown
16-20529..21857 [-], 1329Rlx-like proteinRelaxase, MOBP Family
17-21818..22147 [-], 330unknown
18-22405..22776 [-], 372unknown
19vanRB24047..24709 [+], 663VanRBAR 
20vanSB24709..26052 [+], 1344VanSBAR 
21vanYB26223..27029 [+], 807VanYBAR 
22vanW27047..27874 [+], 828VanWAR 
23vanHB27871..28842 [+], 972VanHBAR 
24vanB28835..29863 [+], 1029VanBAR 
25vanXB29869..30477 [+], 609VanXBAR 
26-31063..31494 [+], 432unknown
27-31501..31731 [+], 231unknown
28xis32148..32348 [+], 201excisionase
29int32432..33625 [+], 1194integraseIntegrase 
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins29Fasta
(1) Foucault ML; Depardieu F; Courvalin P; Grillot-Courvalin C (2010). Inducible expression eliminates the fitness cost of vancomycin resistance in enterococci. Proc Natl Acad Sci U S A. 107(39):16964-9. [PudMed:20833818] experimental
(2) Tsvetkova K; Marvaud JC; Lambert T (2010). Analysis of the mobilization functions of the vancomycin resistance transposon Tn1549, a member of a new family of conjugative elements. J Bacteriol. 192(3):702-13. [PudMed:19966009] experimental
(3) Garnier F; Taourit S; Glaser P; Courvalin P; Galimand M (2000). Characterization of transposon Tn1549, conferring VanB-type resistance in Enterococcus spp. Microbiology. 146 ( Pt 6):1481-9. [PudMed:10846226] experimental
 
experimental experimental literature