ICEberg
I. Information of ICE
ICEberg ID839
Name ICESsuT15 This is a predicted ICE derived from literature
FamilyICESa2603
OrganismStreptococcus suis T15
Size (bp)71412
GC content [Genome] (%)36.3
Insertion siteCCTCTTATGTCAAGTAACTG(attL)CATTATTATGACACAATCCC(attR)
Function-
Species that ICE can be transferred to-
Nucleotide SequenceCP006246 (ICE sequence without defined boundaries)
Putative oriT region -
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of ICESsuT15 is not available.

 

The gene information of ICESsuT15 is not available.
ElementNo. of sequencesDownload
Nucleotide sequences0Fasta
Proteins0Fasta
(1) Huang J; Liang Y; Guo D; Shang K; Ge L; Kashif J; Wang L (2016). Comparative Genomic Analysis of the ICESa2603 Family ICEs and Spread of erm(B)- and tet(O)-Carrying Transferable 89K-Subtype ICEs in Swine and Bovine Isolates in China. Front Microbiol. 7:55. [PudMed:26870017]