ICEberg
I. Information of ICE
ICEberg ID829
Name ICESsu05SC260 This ICE is derived from experimental literature
FamilyUnclassified
OrganismStreptococcus suis 05SC260
Size (bp)88,874
GC content [Genome] (%)36.81
Insertion siterplL
FunctionAntibiotic resistance genes: sat4, tet(M)
Species that ICE can be transferred toStreptococcus suis P1/7RF; Streptococcus suis SS-1RF
Nucleotide SequenceKX077888 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates875..89748 
Putative oriT region coordinates: 31566..31698;   oriTDB id:  200001
GTATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTGTAACCAAAGGATTTT
CTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACGGGGGGTTAAGT
Putative relaxase coordinates: 30350..31555;   Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICESsu05SC260 is not available.



The graph information of ICESsu05SC260 components from KX077888
Complete gene list of ICESsu05SC260 from KX077888
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-1..750 [-], 750putative hydrolase (HAD superfamily)
2-935..2134 [-], 1200integrase
3-2157..2384 [-], 228hypothetical protein
4-2438..2560 [+], 123hypothetical protein
5-2663..2884 [-], 222transcriptional regulator, Cro/CI family
6-3214..4311 [-], 1098sensor-receptor histidine kinase NisK
7-4296..4979 [-], 684hypothetical protein
8-5010..5717 [-], 708hypothetical protein
9-5714..6502 [-], 789hypothetical protein
10-6495..7211 [-], 717putative transport ATP-binding protein
11-7232..9454 [-], 2223ABC transporter, NBP/MSD fusion protein
12-9458..9709 [-], 252hypothetical protein
13-9721..11448 [-], 1728putative asparagine synthetase
14-11564..11692 [-], 129hypothetical protein
15-11924..12046 [-], 123hypothetical protein
16-12377..14242 [-], 1866relaxase
17-14229..14594 [-], 366hypothetical protein
18-14594..15082 [-], 489hypothetical protein
19-15324..16220 [+], 897Abi-alpha protein
20-16342..17559 [-], 1218integraseIntegrase 
21-17641..17844 [-], 204Xis-Tn protein
22-18113..18241 [+], 129hypothetical protein
23-18305..18535 [-], 231hypothetical protein
24-18532..18954 [-], 423hypothetical protein
25-19458..19811 [+], 354hypothetical protein
26-20157..22076 [-], 1920tetracycline resistance protein TetMAR 
27-22453..23385 [-], 933hypothetical proteinOrf13_Tn, T4SS component 
28-23382..24383 [-], 1002NLP/P60 family lipoproteinOrf14_Tn, T4SS component 
29-24380..26491 [-], 2112putative membrane proteinOrf15_Tn, T4SS component 
30-26560..29007 [-], 2448hypothetical proteinOrf16_Tn, T4SS component 
31-28991..29383 [-], 393hypothetical proteinOrf17_Tn, T4SS component 
32-29472..29969 [-], 498antirestriction protein
33-30086..30307 [-], 222conjugation related proteinOrf19_Tn, T4SS component 
34-30350..31555 [-], 1206putative transcriptional regulatorRelaxase, MOBT Family
35-31578..31730 [-], 153hypothetical protein
36-31733..33118 [-], 1386hypothetical proteinOrf21_Tn, T4SS component 
37-33147..33530 [-], 384hypothetical protein
38-33549..33863 [-], 315hypothetical protein
39-33886..34005 [-], 120hypothetical protein
40-34225..34524 [+], 300Abi-alpha protein
41-34619..36436 [-], 1818UvrD/REP helicase family protein
42-36423..38510 [-], 2088putative ATP-dependent endonuclease
43-38507..39283 [-], 777zeta toxin
44-39283..39759 [-], 477transcription regulator, probable
45-39829..40119 [-], 291hypothetical protein
46-40169..40558 [-], 390hypothetical protein
47-40555..40782 [-], 228hypothetical protein
48-40836..41912 [-], 1077hypothetical protein
49-41951..42589 [-], 639hypothetical proteinPrgL, T4SS component 
50-42588..42722 [+], 135hypothetical protein
51-43990..44589 [-], 600DNA-binding response regulator
52-44567..46075 [-], 1509putative two-component sensor histidine kinase
53-46079..46768 [-], 690hypothetical protein
54-46778..47497 [-], 720hypothetical protein
55-47475..48389 [-], 915putative lantibiotic ABC transporter,ATP-binding
56-48361..50430 [-], 2070lipid A export ATP-binding/permease protein MsbA
57-50442..51554 [-], 1113lantibiotic modifying enzyme
58-51657..51773 [+], 117DNA topoisomerase III
59-51881..52378 [+], 498putative DNA recombinase
60-52379..52795 [+], 417recombinase
61-52797..54359 [+], 1563putative DNA recombinase
62-54502..54726 [+], 225helix-turn-helix domain protein
63-54741..55610 [+], 870hypothetical protein
64-55591..56325 [+], 735ubiquinone/menaquinone biosynthesis
65-56358..57221 [+], 864putative aminoglycoside 6-adenylyltansferase
66-57265..57792 [+], 528adenine phosphoribosyltransferase
67-58020..59339 [+], 1320transposase
68-59528..60925 [-], 1398lantibiotic mersacidin modifying enzyme
69-61009..61182 [-], 174hypothetical protein
70-61523..61819 [-], 297hypothetical protein
71-61833..62132 [-], 300hypothetical protein
72-62203..69027 [-], 6825SNF2 family protein
73-69077..69628 [-], 552hypothetical protein
74-69612..69803 [-], 192putative calcium-binding protein
75-69804..74699 [-], 4896agglutinin receptorPrgB, T4SS component 
76-74679..74834 [+], 156hypothetical protein
77-74871..75461 [+], 591abortive infection protein AbiGI
78-75458..76303 [+], 846abortive infection protein AbiGII
79-76366..79167 [-], 2802hypothetical proteinPrgK, T4SS component 
80-79169..81520 [-], 2352TrsE-like proteinPrgJ, T4SS component 
81-81477..81830 [-], 354hypothetical protein
82-81892..82746 [-], 855hypothetical protein
83-82765..83007 [-], 243hypothetical protein
84-83025..84842 [-], 1818hypothetical protein
85-84842..85330 [-], 489hypothetical protein
86-85408..85992 [-], 585hypothetical protein
87-85995..86228 [-], 234hypothetical protein
88-86237..86620 [-], 384hypothetical protein
89-86631..87059 [-], 429hypothetical protein
90-87043..88398 [-], 1356modification methylase
91-88547..89365 [-], 819hypothetical protein
92-89362..89535 [-], 174hypothetical protein
93-89595..89714 [-], 120hypothetical protein
94-89734..90099 [-], 366LSU ribosomal protein L7/L12 (P1/P2)
 
flank Flanking regions
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins92Fasta
(1) Huang J; Ma J; Shang K; Hu X; Liang Y; Li D; Wu Z; Dai L; Chen L; Wang L (2016). Evolution and Diversity of the Antimicrobial Resistance Associated Mobilome in Streptococcus suis: A Probable Mobile Genetic Elements Reservoir for Other Streptococci. Front Cell Infect Microbiol. 0.331944444. [PudMed:27774436]