ICEberg
I. Information of ICE
ICEberg ID811
Name ICESluvan This ICE is derived from experimental literature
FamilyUnclassified
OrganismStreptococcus lutetiensis 5-F9
Size (bp)94189
GC content [Genome] (%)43.96
Insertion sitetRNA (uracil-5)-methyltransferase rumA; CACGTGGAGTGCGTAGTGTT(attL); TTCTCAAGGACCAGACAACA(attR)
Functionglycopeptide and bacitracin resistance
Species that ICE can be transferred to-
Nucleotide SequenceHE963029 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..94189 
Putative oriT region coordinates: 44538..44565;   oriTDB id:  200002
GGGAGTGGCTACACTCCCTATGCTTGCT
Putative relaxase coordinates: 42828..44156;   Family:  MOBP


II. ICE interaction with IME/CIME/

The interaction information of ICESluvan is not available.



The graph information of ICESluvan components from HE963029
Complete gene list of ICESluvan from HE963029
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-9..176 [+], 168putative uncharacterized protein
2-253..426 [+], 174putative uncharacterized protein
3repA423..1241 [+], 819replication initiator protein
4-1390..2745 [+], 1356cytosine-specific methyltransferase
5-2729..3157 [+], 429putative uncharacterized protein
6-3168..3551 [+], 384putative uncharacterized protein
7-3560..3793 [+], 234putative uncharacterized protein
8-3796..4380 [+], 585CAAX amino terminal protease self-immunity protein
9-4421..4945 [+], 525putative uncharacterized protein
10-6767..7021 [+], 255putative membrane protein
11-7045..7899 [+], 855putative plasmid conjugal transfer protein,TrbL/VirB6 family
12-7859..8314 [+], 456putative uncharacterized protein
13-8292..10622 [+], 2331putative conjugal transfer proteinPrgJ, T4SS component 
14-10624..13425 [+], 2802N-acetylmuramoyl L-alanine amidasePrgK, T4SS component 
15-13838..15037 [+], 1200putative uncharacterized protein
16-15059..15271 [+], 213putative uncharacterized protein
17-15346..15822 [+], 477putative uncharacterized protein
18-15819..17513 [+], 1695putative conjugal transfer protein, TraG/TraD family
19-17672..17920 [+], 249putative conjugal transfer protein
20-18003..18875 [+], 873membrane protein, putative conjugative transfer protein
21-18906..19448 [+], 543adenine-specific methyltransferase
22-19462..19884 [+], 423putative uncharacterized protein
23-19814..22213 [+], 2400putative conjugal transfer protein
24-22245..24236 [+], 1992DNA-repair proteinOrf14_Tn, T4SS component 
25-24259..24510 [+], 252putative uncharacterized protein
26-24500..25729 [+], 1230putative bacteriocin
27-25726..36520 [+], 10795DNA topoisomerase (pseudogene)
28-27204..29066 [+], 1863TnpX site-specific recombinase
29-29253..29549 [+], 297putative uncharacterized protein
30-29680..30733 [+], 1054transposase, IS30 family (pseudogene)
31-30982..31470 [+], 489putative VanZ family protein
32-31555..31881 [+], 327putative uncharacterized protein
33-32121..33629 [+], 1509putative mobilization protein, conjugal transfer protein
34-33626..35527 [+], 1902putative DNA primase
35-35646..35837 [+], 192putative uncharacterized protein
36-36669..40589 [+], 3921putative uncharacterized protein, LtrC family
37-40590..41534 [+], 945putative uncharacterized protein
38-42041..42430 [-], 390putative uncharacterized protein
39-42460..42816 [-], 357putative uncharacterized protein
40-42828..44156 [-], 1329putative mobilization proteinRelaxase, MOBP Family
41-44117..44446 [-], 330putative mobilization protein, MobC
42-44704..45075 [-], 372putative uncharacterized protein
43-45220..45405 [+], 186transposase
44-45563..45730 [+], 168putative uncharacterized protein
45vanRB46349..47008 [+], 660response regulator VanRBAR 
46vanSB47011..48354 [+], 1344sensor protein, histidine kinase VanSBAR 
47vanYB48525..49331 [+], 807carboxypeptidase VanYAR 
48vanW49328..50176 [+], 849vancomycin resistance protein VanWAR 
49vanH50173..51144 [+], 972vancomycin resistance protein VanHAR 
50vanB51137..52165 [+], 1029vancomycin B-type resistance protein VanB2AR 
51vanX52171..52779 [+], 609vancomycin B-type resistance protein VanXAR 
52-53022..53798 [+], 777putative uncharacterized protein
53-53805..54038 [+], 234putative uncharacterized protein
54-53960..54202 [-], 243putative uncharacterized protein
55xis54462..54662 [+], 201excisionase
56int54665..55939 [+], 1275integraseIntegrase 
57-56862..57452 [-], 591putative abortive infection protein AbiGI
58-57625..62520 [+], 4896agglutinin receptorPrgB, T4SS component 
59-62521..62712 [+], 192putative calcium-binding protein
60-62696..63247 [+], 552putative uncharacterized protein
61-70169..70468 [+], 300putative uncharacterized protein
62-70482..70781 [+], 300putative uncharacterized protein
63-71481..72686 [+], 1206putative uncharacterized phage related proteinT4CP 
64-72683..74011 [+], 1329putative uncharacterized phage related protein
65-75699..76337 [+], 639putative uncharacterized protein
66-76377..77453 [+], 1077putative DNA primase
67-77507..77734 [+], 228putative uncharacterized protein
68-77731..78120 [+], 390putative uncharacterized protein
69-78170..78460 [+], 291putative uncharacterized protein
70-78500..79006 [+], 507putative antidote epsilon protein, zeta toxin regulator
71-79006..79776 [+], 771putative zeta-toxin/signal recognition particle
72-79808..82315 [+], 2508putative uncharacterized protein
73-82636..82995 [+], 360putative uncharacterized protein
74-83005..83370 [+], 366putative mobilisation protein, MobC family
75-83357..85222 [+], 1866relaxase
76-86634..87383 [+], 750ABC-type antimicrobial peptide transport system,ATPase component
77-87396..89414 [+], 2019ABC-type antimicrobial peptide transport system,permease component
78-89504..91078 [+], 1575histidine kinase
79SalR91059..91655 [+], 597response regulator
80-91761..91982 [+], 222transcriptional regulator, Cro/CI family
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins80Fasta
(1) Bjorkeng EK; Hjerde E; Pedersen T; Sundsfjord A; Hegstad K (2013). ICESluvan, a 94-kilobase mosaic integrative conjugative element conferring interspecies transfer of VanB-type glycopeptide resistance, a novel bacitracin resistance locus, and a toxin-antitoxin stabilization system. J Bacteriol. 195(23):5381-90. [PudMed:24078615]