ICEberg
I. Information of ICE
ICEberg ID80
Name ICESpn8140 This is a predicted ICE derived from literature
FamilyICESt1
OrganismStreptococcus pneumoniae 8140
Size (bp)26888
GC content [Genome] (%)36.06
Insertion site-
Function-
Species that ICE can be transferred to-
Nucleotide SequenceFR671412 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..26888 
Putative oriT region coordinates: 15331..15543;   oriTDB id:  200004
GCCTGACCGCAGGTCAGGCGCAGACCGTAGCCCGAAGTCTCTAGGCCATGATGAAACTTCAACCCCCGTT
TTCTAATAGGGGGGTTACATTTGGCAAATACGCCAAGTCCACCCCTCCTCATTCCTTATGGGAGTTGGGT
TTTCAATTTTTATGAAGTGTGTCACTTTCGTCAAAAAAGTGTGTCACTTTGTTAGAAAGAGGTGTTGCGA
TGA
Putative relaxase coordinates: 15544..16776;   Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICESpn8140 is not available.



The graph information of ICESpn8140 components from FR671412
Complete gene list of ICESpn8140 from FR671412
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-323..511 [+], 189Conserved hypothetical protein
2-504..1115 [+], 612Fic/DOC domain protein
3-1370..1732 [+], 363Membrane protein
4-2050..2646 [-], 597Response regulator
5-2627..3868 [-], 1242Sensor histidine kinase
6-3890..4060 [+], 171Hypothetical protein
7-4104..4244 [-], 141Hypothetical protein
8-4282..6297 [-], 2016ABC transporter, permease subunit
9-6310..7047 [-], 738ABC-type antimicrobial peptide transport system, ATPase component
10-7407..7520 [-], 114Hypothetical protein
11-7851..8213 [-], 363Hypothetical protein
12-8270..8956 [-], 687Helix-turn-helix DNA binding protein
13-8965..9825 [-], 861Conserved hypothetical protein
14-9946..10131 [-], 186Conserved hypothetical protein
15-10112..11125 [-], 1014Conserved hypothetical protein
16-11155..11571 [-], 417Putative FMN-binding protein
17-11626..11976 [-], 351Helix-turn-helix DNA binding protein
18-12638..12820 [+], 183Hypothetical protein
19-12855..13151 [+], 297Conserved hypothetical protein
20-13173..13634 [+], 462Conserved hypothetical protein
21-13648..15336 [+], 1689FtsK/SpoIIIE proteinYdcQ, T4SS component 
22-15544..16776 [+], 1233Helix-turn-helix DNA binding proteinRelaxase, MOBT Family
23-16791..17024 [+], 234Conserved hypothetical protein
24-17026..17583 [+], 558Putative transfer protein
25-17594..18589 [+], 996Putative transfer proteinYddB, T4SS component 
26-18599..18823 [+], 225Conserved hypothetical protein
27-18826..19236 [+], 411Putative transfer proteinYddD, T4SS component 
28-19250..21754 [+], 2505Putative conjugative transfer ATP/GTP-binding proteinYddE, T4SS component 
29-21766..23631 [+], 1866Putative conjugative transfer membrane-associated proteinYddG, T4SS component 
30-23633..23857 [+], 225Putative conjugative transfer protein
31-23874..24986 [+], 1113Cysteine/histidine-dependent peptidaseOrf13_p, T4SS component 
32-25000..25257 [+], 258Putative DNA binding conjugative transfer protein
33-25369..26634 [+], 1266IntegraseIntegrase 
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins33Fasta
(1) Croucher NJ; Harris SR; Fraser C; Quail MA; Burton J; van der Linden M; McGee L; von Gottberg A; Song JH; Ko KS; Pichon B; Baker S; Parry CM; Lambertsen LM; Shahinas D; Pillai DR; Mitchell TJ; Dougan G; Tomasz A; Klugman KP; Parkhill J; Hanage WP; Bentley SD (2011). Rapid pneumococcal evolution in response to clinical interventions. Science. 331(6016):430-4. [PudMed:21273480] experimental
 
experimental experimental literature