ICEberg
I. Information of ICE
ICEberg ID79
Name ICESt3 This ICE is derived from experimental literature
FamilyICESt1
OrganismStreptococcus thermophilus CNRZ385
Size (bp)28091
GC content [Genome] (%)36.9
Insertion sitefda
Function-
Species that ICE can be transferred toStreptococcus pyogenes; Enterococcus faecalis
Nucleotide SequenceAJ586568 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates204..28293 
Putative oriT region coordinates: 16700..16912;   oriTDB id:  200003
CGACGCTTCGAAAGATCATTTATCTCTTGCAAGAACAAGGCATTGTATTCGAACGTTCAGACTCTGCCAT
TCTAGTGAATCCTTTTCAAGAAAAACTTCTTCTTGAAATCCTCGCTCAATTTGAAGAGGGAGGACGCAGG
TCTTATCCAAAAGCAGTTGAAGCGACGATTGTTCATCATGGGCTAGGACAAGGGCAAGGACAAGCCTGAC
CAC
Putative relaxase coordinates: 17116..18348;   Family:  MOBT


II. ICE interaction with IME/CIME/

The Interaction Network among ICE/IME/CIME


Detailed Informatioin of the Interaction Network
# ICE  Inter_Ele [Type] Methods Donors Recipients Exper_Ref 
1ICESt3 IME_GB00957_oriT [IME] insolicoin trans - - -
2ICESt3 CIME19258 [CIME] insolicoin cis - - -
3ICESt3 CIME9 [CIME] insolicoin cis - - -
4ICESt3 CIMEL3catR3 [CIME] experimentalin cis Streptococcus thermophilus Streptococcus thermophilus 21722203

experimental This is an interactioin derived from experimental literature
insolico This is a putative interactioin



The graph information of ICESt3 components from AJ586568
Complete gene list of ICESt3 from AJ586568
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-565..1356 [-], 792hypothetical protein
2-1520..3192 [+], 1673-
3-4092..4466 [+], 375hypothetical protein
4-4483..4785 [+], 303hypothetical protein
5-5079..6176 [+], 1098putative cytosine-specific methyltransferase
6-6163..7389 [+], 1227putative cytosine-specific methyltransferase
7-7414..8457 [-], 1044hypothetical protein
8-8650..9390 [-], 741hypothetical protein
9-9659..10447 [-], 789-
10-10478..10792 [-], 315-
11arp110981..11667 [-], 687putative transcriptional regulator
12-11676..12479 [-], 804putative transcriptional regulator
13-12795..12989 [-], 195putative transmembrane protein
14-13029..13217 [-], 189putative transcriptional regulator
15arp213223..13564 [-], 342putative transcriptional regulator
16-14427..14723 [+], 297putative transfer proteinOrfM; conjugative transfer; [PMID: 15073287
17-14745..15206 [+], 462putative transfer proteinOrfL; conjugative transfer; [PMID: 15073287
18-15220..16908 [+], 1689putative transfer proteinYdcQ, T4SS component 
19-17116..18348 [+], 1233putative transfer proteinRelaxase, MOBT Family
20-18363..18593 [+], 231hypothetical protein
21-18597..19154 [+], 558putative transfer proteinOrfH; conjugative transfer; [PMID: 15073287
22-19166..20161 [+], 996putative transfer proteinOrfG; conjugative transfer; [PMID: 15073287
23-20171..20395 [+], 225putative transfer proteinOrfF; conjugative transfer; [PMID: 15073287
24-20398..20808 [+], 411putative transfer proteinYddD, T4SS component 
25-20822..23326 [+], 2505putative transfer proteinYddE, T4SS component 
26-23338..25218 [+], 1881putative transfer proteinYddG, T4SS component 
27-25220..25444 [+], 225hypothetical protein
28-25470..26582 [+], 1113putative transfer proteinOrf13_p, T4SS component 
29xis26596..26844 [+], 249excisionaseXis; excisionase; [PMID: 15073287
30int26844..28190 [+], 1347tyrosine integraseIntegrase 
31fda28274..28369 [-], 96putative fructose-1,6-diphosphate aldolase
 
flank Flanking regions
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins27Fasta
(1) Carraro N; Libante V; Morel C; Decaris B; Charron-Bourgoin F; Leblond P; Guedon G (2011). Differential regulation of two closely related integrative and conjugative elements from Streptococcus thermophilus. BMC Microbiol. 0.623611111. [PudMed:22024428] experimental
(2) Bellanger X; Morel C; Gonot F; Puymege A; Decaris B; Guedon G (2011). Site-specific accretion of an integrative conjugative element together with a related genomic island leads to cis mobilization and gene capture. Mol Microbiol. 81(4):912-25. [PudMed:21722203] experimental
(3) Bellanger X; Roberts AP; Morel C; Choulet F; Pavlovic G; Mullany P; Decaris B; Guedon G (2009). Conjugative transfer of the integrative conjugative elements ICESt1 and ICESt3 from Streptococcus thermophilus. J Bacteriol. 191(8):2764-75. [PudMed:19181800] experimental
(4) Bellanger X; Morel C; Decaris B; Guedon G (2008). Regulation of excision of integrative and potentially conjugative elements from Streptococcus thermophilus: role of the arp1 repressor. J Mol Microbiol Biotechnol. 14(1-3):16-21. [PudMed:17957106] experimental
(5) Bellanger X; Morel C; Decaris B; Guedon G (2007). Derepression of excision of integrative and potentially conjugative elements from Streptococcus thermophilus by DNA damage response: implication of a cI-related repressor. J Bacteriol. 189(4):1478-81. [PudMed:17114247] experimental
(6) Pavlovic G; Burrus V; Gintz B; Decaris B; Guedon G (2004). Evolution of genomic islands by deletion and tandem accretion by site-specific recombination: ICESt1-related elements from Streptococcus thermophilus. Microbiology. 150(Pt 4):759-74. [PudMed:15073287] experimental
 
experimental experimental literature