ICEberg
I. Information of ICE
ICEberg ID78
Name ICESt1 This ICE is derived from experimental literature
FamilyICESt1
OrganismStreptococcus thermophilus CNRZ368
Size (bp)35870
GC content [Genome] (%)34.99
Insertion sitefda
FunctionType II Restriction-Modification System
Species that ICE can be transferred to-
Nucleotide SequenceAJ278471 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1290..36049 
Putative oriT region coordinates: 23370..23582;   oriTDB id:  200004
GTTTTATTCTGGAAGGCAATAAATTTCAAGACCGTTTTCTCAATCTTGGGTCTACCCTTGAAGTCATGTT
TAATGGGGATTTCCGTAATAAAACATTTGATAAACGGTTCATCACCTATGACATTGCCATCAACCGCATT
GATAGCCGTATCACCATTAATGAGGTCGAGGTAAAGGGTTCTAAACTCCAACTTATGACAGACGTCACTT
GGG
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of ICESt1 is not available.



The graph information of ICESt1 components from AJ278471
Complete gene list of ICESt1 from AJ278471
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-1752..2936 [-], 1185putative Abi-alpha protein
2gst3491..4708 [+], 1218putative glutamate/aspartate-proton symport protein
3-4728..5657 [+], 930putative carboxylate-amine/thiol ligase
4-5841..7016 [-], 1176putative transposase
5-9382..10515 [-], 1134putative ATP/GTP-binding protein
6-10516..11286 [-], 771hypothetical protein
7-11316..11339 [-], 24ORFV1 protein
8-11774..12199 [+], 426hypothetical protein
9-12382..14103 [-], 1722putative ATP/GTP-binding protein
10-14462..14767 [+], 306hypothetical protein
11sth368IR14837..16312 [-], 1476R.Sth368I endonuclease
12sth368IM16428..17693 [+], 1266M.Sth368I methyltransferase
13-17725..18024 [-], 300hypothetical protein
14arp118017..18715 [-], 699hypothetical transcriptional regulator
15-18724..19581 [-], 858hypothetical protein
16-19679..20995 [-], 1317hypothetical protein
17arp220985..21320 [-], 336hypothetical transcriptional regulator
18-22183..22479 [+], 297hypothetical protein
19-22501..22962 [+], 462hypothetical proteinOrfM; conjugative transfer; [PMID: 15073287
20-22976..24664 [+], 1689putative transfer proteinYdcQ, T4SS component 
21-24872..26104 [+], 1233putative transfer proteinOrfK; conjugative transfer; [PMID: 15073287
22-26119..26349 [+], 231hypothetical proteinOrfJ; conjugative transfer; [PMID: 15073287
23-26354..26911 [+], 558hypothetical protein
24ORFH26414..26911 [+], 498hypothetical proteinOrfH; conjugative transfer; [PMID: 15073287
25-26923..27918 [+], 996putative transfer proteinOrfG; conjugative transfer; [PMID: 15073287
26-27928..28152 [+], 225hypothetical proteinOrfF; conjugative transfer; [PMID: 15073287
27ORFE28155..28532 [+], 378putative transfer proteinYddD, T4SS component 
28-28578..31082 [+], 2505putative ATP/GTP-binding proteinYddE, T4SS component 
29-31094..32974 [+], 1881putative transmembrane proteinYddG, T4SS component 
30-32976..33200 [+], 225hypothetical protein
31-33226..34338 [+], 1113putative transfer proteinOrf13_p, T4SS component 
32xis34352..34600 [+], 249excisionaseexcisionase; [PMID: 15073287
33int34600..35946 [+], 1347integraseIntegrase 
34fda36030..36272 [-], 243putative fructose-1,6-biphosphate aldolase
 
flank Flanking regions
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins33Fasta
(1) Carraro N; Libante V; Morel C; Decaris B; Charron-Bourgoin F; Leblond P; Guedon G (2011). Differential regulation of two closely related integrative and conjugative elements from Streptococcus thermophilus. BMC Microbiol. 0.623611111. [PudMed:22024428] experimental
(2) Bellanger X; Roberts AP; Morel C; Choulet F; Pavlovic G; Mullany P; Decaris B; Guedon G (2009). Conjugative transfer of the integrative conjugative elements ICESt1 and ICESt3 from Streptococcus thermophilus. J Bacteriol. 191(8):2764-75. [PudMed:19181800] experimental
(3) Bellanger X; Morel C; Decaris B; Guedon G (2008). Regulation of excision of integrative and potentially conjugative elements from Streptococcus thermophilus: role of the arp1 repressor. J Mol Microbiol Biotechnol. 14(1-3):16-21. [PudMed:17957106] experimental
(4) Bellanger X; Morel C; Decaris B; Guedon G (2007). Derepression of excision of integrative and potentially conjugative elements from Streptococcus thermophilus by DNA damage response: implication of a cI-related repressor. J Bacteriol. 189(4):1478-81. [PudMed:17114247] experimental
(5) Pavlovic G; Burrus V; Gintz B; Decaris B; Guedon G (2004). Evolution of genomic islands by deletion and tandem accretion by site-specific recombination: ICESt1-related elements from Streptococcus thermophilus. Microbiology. 150(Pt 4):759-74. [PudMed:15073287] experimental
(6) Burrus V; Pavlovic G; Decaris B; Guedon G (2002). The ICESt1 element of Streptococcus thermophilus belongs to a large family of integrative and conjugative elements that exchange modules and change their specificity of integration. Plasmid. 48(2):77-97. [PudMed:12383726] experimental in_silico
(7) Burrus V; Bontemps C; Decaris B; Guedon G (2001). Characterization of a novel type II restriction-modification system, Sth368I, encoded by the integrative element ICESt1 of Streptococcus thermophilus CNRZ368. Appl Environ Microbiol. 67(4):1522-8. [PudMed:11282600] experimental
(8) Burrus V; Roussel Y; Decaris B; Guedon G (2000). Characterization of a novel integrative element, ICESt1, in the lactic acid bacterium Streptococcus thermophilus. Appl Environ Microbiol. 66(4):1749-53. [PudMed:10742276] experimental
 
experimental experimental literature
in_silico in silico analysis literature