ICEberg
I. Information of ICE
ICEberg ID753
Name ICE_SsaT93_fda This is a predicted ICE derived from literature
FamilyUnclassified
OrganismStreptococcus salivarius T93
Size (bp)28,421
GC content [Genome] (%)35.71
Insertion sitefda
Function-
Species that ICE can be transferred to-
Nucleotide SequenceLT622837 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..28421 
Putative oriT region coordinates: 17011..17223;   oriTDB id:  200003
GCCTGACTACAGGTCAGGCGCAGATCGTAGCCCGAAGTTCCTAGTCCATGATGAGACTTCAACCCCCGAT
TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA
TTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTTCCCA
TGA
Putative relaxase coordinates: 17224..18456; Gene: ORFJ;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICE_SsaT93_fda is not available.



The graph information of ICE_SsaT93_fda components from LT622837
Complete gene list of ICE_SsaT93_fda from LT622837
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-923..3196 [-], 2274Putative permease protein
2-3212..3886 [-], 675ABC transporter ATP-binding protein
3-3895..4671 [-], 777hypothetical protein
4avrD4661..5599 [-], 939Avirulence AvrD-like protein
5-5716..6315 [-], 600Two-component system TCS response regulator
6-6308..8080 [-], 1773Two-component system TCS Histidine kinase
7-8867..9304 [-], 438hypothetical protein
8-9456..9752 [-], 297hypothetical protein
9arp19745..10443 [-], 699putative transcriptional regulator Arp1
10ORFQ10452..11312 [-], 861putative ImmA protease
11-11525..12397 [-], 873hypothetical protein
12-12661..13179 [-], 519hypothetical protein
13arp213340..13681 [-], 342putative transcriptional regulator Arp2
14ORFO14249..14278 [+], 30conserved protein of unknown function
15ORFN14313..14495 [+], 183conserved protein of unknown function
16ORFM14535..14831 [+], 297Putative conjugal transfer protein
17ORFL14853..15314 [+], 462Putative conjugal transfer protein
18ORFK15328..17016 [+], 1689FtsK/SpoIIIE family coupling proteinYdcQ, T4SS component 
19ORFJ17224..18456 [+], 1233Putative relaxaseRelaxase, MOBT Family
20ORFI18471..18701 [+], 231Putative conjugal transfer protein
21ORFH18706..19263 [+], 558Putative conjugal transfer protein
22ORFG19275..20270 [+], 996Putative conjugal transfer protein
23ORFF20280..20504 [+], 225Putative conjugal transfer protein
24ORFE20507..20917 [+], 411Putative conjugal transfer proteinYddD, T4SS component 
25ORFD20931..23435 [+], 2505Putative conjugal transfer proteinYddE, T4SS component 
26ORFC23447..25327 [+], 1881Putative conjugal transfer proteinYddG, T4SS component 
27ORFB25329..25553 [+], 225Putative conjugal transfer protein
28ORFA25570..26682 [+], 1113Putative conjugal transfer proteinOrf13_p, T4SS component 
29xis26696..26944 [+], 249Excisionase
30int26944..28290 [+], 1347Tyrosine integraseIntegrase 
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins30Fasta
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PudMed:28432093] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature