ICEberg
I. Information of ICE
ICEberg ID751
Name ICE_SsaN20_rpsI This is a predicted ICE derived from literature
FamilyUnclassified
OrganismStreptococcus salivarius N20
Size (bp)37,356
GC content [Genome] (%)34.46
Insertion siterpsI
Function-
Species that ICE can be transferred to-
Nucleotide SequenceLT622836 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..37356 
Putative oriT region coordinates: 24568..24780;   oriTDB id:  200003
GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT
TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA
TTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAATTAAAAGGAGGTGTTTCCA
TGA
Putative relaxase coordinates: 24781..26013; Gene: ORFJ;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICE_SsaN20_rpsI is not available.



The graph information of ICE_SsaN20_rpsI components from LT622836
Complete gene list of ICE_SsaN20_rpsI from LT622836
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-217..798 [-], 582hypothetical protein
2cadX1694..2032 [-], 339Cadmium efflux system accessory protein CadX
3cadD2044..2658 [-], 615Cadmium resistance protein CadD
4-3264..3482 [+], 219hypothetical protein
5-3763..5484 [-], 1722hypothetical protein
6-5995..6300 [+], 306hypothetical protein
7sth368IR6363..7847 [-], 1485R.Sth368I endonuclease
8sth368IM7963..9228 [+], 1266Cytosine-specific methyltransferase
9-9258..9557 [-], 300hypothetical protein
10arp19550..10248 [-], 699putative transcriptional regulator Arp1
11tnp10919..11242 [-], 324Transposase
12-11608..12357 [-], 750hypothetical protein
13-12368..14656 [-], 2289hypothetical protein
14-14659..15405 [-], 747hypothetical protein
15-15402..16019 [-], 618hypothetical protein
16-16023..17270 [-], 1248hypothetical protein
17ORFQ18262..19122 [-], 861putative ImmA protease
18-19215..20708 [-], 1494hypothetical protein
19arp220881..21216 [-], 336putative transcriptional regulator Arp2
20ORFO21806..21835 [+], 30conserved protein of unknown function
21ORFN21870..22052 [+], 183conserved protein of unknown function
22ORFM22091..22387 [+], 297Putative conjugal transfer protein
23ORFL22410..22871 [+], 462Putative conjugal transfer protein
24ORFK22885..24573 [+], 1689FtsK/SpoIIIE family coupling proteinYdcQ, T4SS component 
25ORFJ24781..26013 [+], 1233Putative relaxaseRelaxase, MOBT Family
26ORFI26027..26257 [+], 231Putative conjugal transfer protein
27ORFH26261..26818 [+], 558Putative conjugal transfer protein
28ORFG26830..27825 [+], 996Putative conjugal transfer protein
29ORFF27835..28059 [+], 225Putative conjugal transfer protein
30ORFE28062..28472 [+], 411Putative conjugal transfer proteinYddD, T4SS component 
31ORFD28486..30990 [+], 2505Putative conjugal transfer proteinYddE, T4SS component 
32ORFC31002..32882 [+], 1881Putative conjugal transfer proteinYddG, T4SS component 
33ORFB32884..33108 [+], 225Putative conjugal transfer protein
34ORFA33125..34237 [+], 1113Putative conjugal transfer proteinOrf13_p, T4SS component 
35-34550..35692 [+], 1143hypothetical protein
36xis35747..36019 [+], 273Excisionase
37int36030..37250 [+], 1221Tyrosine integraseIntegrase 
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins37Fasta
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PudMed:28432093] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature