ICEberg
I. Information of ICE
ICEberg ID750
Name ICE_SsaL64_fda This is a predicted ICE derived from literature
FamilyUnclassified
OrganismStreptococcus salivarius L64
Size (bp)25,797
GC content [Genome] (%)37.21
Insertion sitefda
Function-
Species that ICE can be transferred to-
Nucleotide SequenceLT622834 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..25797 
Putative oriT region coordinates: 14388..14600;   oriTDB id:  200003
GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT
TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA
TTTCAGGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTGCCCA
TGA
Putative relaxase coordinates: 14601..15833; Gene: ORFJ;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICE_SsaL64_fda is not available.



The graph information of ICE_SsaL64_fda components from LT622834
Complete gene list of ICE_SsaL64_fda from LT622834
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-418..1440 [-], 1023hypothetical protein
2repA2791..3150 [-], 360RepA
3-3359..3676 [+], 318hypothetical protein
4-3906..4367 [-], 462hypothetical protein
5-4399..5271 [-], 873hypothetical protein
6dcm5283..7364 [-], 2082Cytosine-specific methyltransferase
7arp17567..8253 [-], 687putative transcriptional regulator Arp1
8ORFQ8262..9122 [-], 861putative ImmA protease
9-9218..10705 [-], 1488hypothetical protein
10arp210705..11046 [-], 342putative transcriptional regulator Arp2
11ORFO11627..11656 [+], 30conserved protein of unknown function
12ORFN11691..11873 [+], 183conserved protein of unknown function
13ORFM11912..12208 [+], 297Putative conjugal transfer protein
14ORFL12230..12691 [+], 462Putative conjugal transfer protein
15ORFK12705..14393 [+], 1689FtsK/SpoIIIE family coupling proteinYdcQ, T4SS component 
16ORFJ14601..15833 [+], 1233Putative relaxaseRelaxase, MOBT Family
17ORFI15848..16078 [+], 231Putative conjugal transfer protein
18ORFH16082..16639 [+], 558-
19ORFG16651..17646 [+], 996Putative conjugal transfer protein
20ORFF17656..17880 [+], 225Putative conjugal transfer protein
21ORFE17883..18293 [+], 411Putative conjugal transfer proteinYddD, T4SS component 
22ORFD18307..20811 [+], 2505Putative conjugal transfer proteinYddE, T4SS component 
23ORFC20823..22703 [+], 1881Putative conjugal transfer proteinYddG, T4SS component 
24ORFB22705..22929 [+], 225Putative conjugal transfer protein
25ORFA22946..24058 [+], 1113Putative conjugal transfer proteinOrf13_p, T4SS component 
26xis24072..24320 [+], 249Excisionase
27int24320..25666 [+], 1347Tyrosine integraseIntegrase 
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins27Fasta
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PudMed:28432093] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature