ICEberg
I. Information of ICE
ICEberg ID747
Name ICE_SsaL22_fda This is a predicted ICE derived from literature
FamilyUnclassified
OrganismStreptococcus salivarius L22
Size (bp)37,240
GC content [Genome] (%)35.06
Insertion sitefda
Function-
Species that ICE can be transferred to-
Nucleotide SequenceLT622831 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..37240 
Putative oriT region coordinates: 24205..24417;   oriTDB id:  200003
GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT
TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA
TTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAATTAAAAGGAGGTGTTCCTA
TGA
Putative relaxase coordinates: 24418..25650; Gene: ORFJ;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICE_SsaL22_fda is not available.



The graph information of ICE_SsaL22_fda components from LT622831
Complete gene list of ICE_SsaL22_fda from LT622831
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1slvF713..1390 [+], 678Putative lantibiotic transport ATP-binding protein SlvF
2slvE1392..2120 [+], 729Putative lantibiotic transport membrane protein SlvE
3slvG2107..2757 [+], 651Putative lantibiotic transport protein SlvG
4tnp3615..4196 [-], 582transposase
5slvK4986..6323 [-], 1338Putative sensor histidine kinase SlvK
6slvR6316..7002 [-], 687Putative response regulator SlvR
7slvP6995..8593 [-], 1599Putative serine protease SlvP
8slvI8595..9329 [-], 735Putative immunity protein SlvI
9slvC9342..10562 [-], 1221Putative lantibiotic cyclase SlvC
10slvT10519..12357 [-], 1839Putative ABC transporter SlvT
11slvB12367..15321 [-], 2955Putative lantibiotic dehydratase SlvB
12slvN15433..15594 [-], 162Salivaricin N
13slvD15837..16010 [-], 174Salivaricin D
14slvD16207..16380 [-], 174Salivaricin D
15tnp16756..16917 [+], 162transposase, partial
16tnp17027..17188 [+], 162transposase, partial
17tnp17341..17610 [+], 270transposase, partial
18arp117811..18509 [-], 699putative transcriptional regulator Arp1
19ORFQ18518..19378 [-], 861putative ImmA protease
20-19493..20530 [-], 1038hypothetical protein
21arp220514..20855 [-], 342Putative transcriptional regulator Arp2
22ORFO21444..21473 [+], 30conserved protein of unknown function
23ORFN21508..21690 [+], 183conserved protein of unknown function
24ORFM21729..22025 [+], 297Putative conjugal transfer protein
25ORFL22047..22508 [+], 462Putative conjugal transfer protein
26ORFK22522..24210 [+], 1689FtsK/SpoIIIE family coupling proteinYdcQ, T4SS component 
27ORFJ24418..25650 [+], 1233Putative relaxaseRelaxase, MOBT Family
28ORFI25665..25895 [+], 231Putative conjugal transfer protein
29ORFH25900..26457 [+], 558Putative conjugal transfer protein
30ORFG26469..27464 [+], 996Putative conjugal transfer protein
31ORFF27474..27698 [+], 225Putative conjugal transfer protein
32ORFE27701..28111 [+], 411Putative conjugal transfer proteinYddD, T4SS component 
33ORFD28125..30629 [+], 2505-YddE, T4SS component 
34ORFC30641..32521 [+], 1881Putative conjugal transfer proteinYddG, T4SS component 
35ORFB32523..32747 [+], 225Putative conjugal transfer protein
36ORFA32764..33876 [+], 1113Putative conjugal transfer proteinOrf13_p, T4SS component 
37-33977..35179 [+], 1203hypothetical protein
38xis35563..35811 [+], 249Excisionase
39int35811..37157 [+], 1347Tyrosine integraseIntegrase 
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins39Fasta
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PudMed:28432093] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature