ICEberg
I. Information of ICE
ICEberg ID744
Name ICE_SsaF1-8_rpmG This is a predicted ICE derived from literature
FamilyUnclassified
OrganismStreptococcus salivarius F1-8
Size (bp)27,272
GC content [Genome] (%)36.29
Insertion siterpmG
Function-
Species that ICE can be transferred to-
Nucleotide SequenceLT622828 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..27272 
Putative oriT region coordinates: 14062..14274;   oriTDB id:  200004
GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAAACTTCAACCCCCGAT
TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA
TTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTTCCCA
TGA
Putative relaxase coordinates: 14275..15507; Gene: ORFJ;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICE_SsaF1-8_rpmG is not available.



The graph information of ICE_SsaF1-8_rpmG components from LT622828
Complete gene list of ICE_SsaF1-8_rpmG from LT622828
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-164..1084 [-], 921hypothetical protein
2-1074..1853 [-], 780hypothetical protein
3-2128..2781 [-], 654hypothetical protein
4-3225..3524 [+], 300hypothetical protein
5-3814..4275 [-], 462hypothetical protein
6-4307..5179 [-], 873hypothetical protein
7dcm5191..7272 [-], 2082Cytosine-specific methyltransferase
8arp17475..8161 [-], 687putative transcriptional regulator Arp1
9ORFQ8171..9031 [-], 861putative ImmA protease
10-9122..10363 [-], 1242hypothetical protein
11arp210372..10719 [-], 348Putative transcriptional regulator Arp2
12ORFO11301..11330 [+], 30conserved protein of unknown function
13ORFN11365..11547 [+], 183conserved protein of unknown function
14ORFM11586..11882 [+], 297Putative conjugal transfer protein
15ORFL11904..12365 [+], 462Putative conjugal transfer protein
16ORFK12379..14067 [+], 1689FtsK/SpoIIIE family coupling proteinYdcQ, T4SS component 
17ORFJ14275..15507 [+], 1233-Relaxase, MOBT Family
18ORFI15522..15752 [+], 231Putative conjugal transfer protein
19ORFH15756..16313 [+], 558Putative conjugal transfer protein
20ORFG16325..17320 [+], 996Putative conjugal transfer protein
21ORFF17330..17554 [+], 225Putative conjugal transfer protein
22ORFE17557..17967 [+], 411Putative conjugal transfer proteinYddD, T4SS component 
23ORFD17981..20485 [+], 2505Putative conjugal transfer proteinYddE, T4SS component 
24ORFC20497..22377 [+], 1881Putative conjugal transfer proteinYddG, T4SS component 
25ORFB22379..22603 [+], 225Putative conjugal transfer protein
26ORFA22620..23732 [+], 1113Putative conjugal transfer proteinOrf13_p, T4SS component 
27xis23746..24003 [+], 258Putative excisionase
28int24014..25285 [+], 1272tyrosine integraseIntegrase 
29-25653..26240 [+], 588hypothetical protein
30-26254..26598 [+], 345hypothetical protein
31secB26599..27033 [+], 435Preprotein translocase, SecB subunit
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins31Fasta
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PudMed:28432093] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature