ICEberg
I. Information of ICE
ICEberg ID743
Name ICE_SsaF1-4_fda This ICE is derived from experimental literature
FamilyUnclassified
OrganismStreptococcus salivarius F1-4
Size (bp)29,716
GC content [Genome] (%)35.33
Insertion sitefda
Function-
Species that ICE can be transferred toStreptococcus salivarius; Streptococcus thermophilus; Enterococcus faecalis
Nucleotide SequenceLT622827 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..29716 
Putative oriT region coordinates: 18355..18567;   oriTDB id:  200003
GCCTGACCAAAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT
TTCTAATAGGGGGGTTACATTTGGCCAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA
TTTCAAGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAGTCAAAAGGAGGTGTTCCCA
TGA
Putative relaxase coordinates: 18568..19800; Gene: ORFJ;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICE_SsaF1-4_fda is not available.



The graph information of ICE_SsaF1-4_fda components from LT622827
Complete gene list of ICE_SsaF1-4_fda from LT622827
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-597..1973 [-], 1377hypothetical protein
2-2261..4069 [+], 1809-
3-4167..4466 [+], 300hypothetical protein
4LfaORFAP4729..6156 [-], 1428Type II restriction-modification system restriction subunit
5LfaORFBP6164..7204 [-], 1041Type II restriction-modification system restriction subunit
6-7194..7910 [-], 717hypothetical protein
7dcm_27994..9022 [-], 1029Cytosine-5-methyltransferase
8dcm_19012..10085 [-], 1074Cytosine-specific methyltransferase
9-10082..10294 [-], 213putative transcriptional regulator, XRE family
10-10447..10755 [-], 309hypothetical protein
11arp110748..11449 [-], 702putative transcriptional regulator Arp1
12ORFQ11458..12318 [-], 861putative ImmA protease
13-13465..14418 [-], 954hypothetical protein
14-14473..14655 [-], 183XRE family transcriptional regulator
15arp214661..15002 [-], 342Putative transcriptional regulator Arp2
16ORFO15593..15622 [+], 30Conserved protein of unknown function
17ORFN15657..15839 [+], 183Conserved protein of unknown function
18ORFM15878..16174 [+], 297putative conjugal transfer protein
19ORFL16197..16658 [+], 462putative conjugal transfer protein
20ORFK16672..18360 [+], 1689FtsK-SpoIIIE family coupling proteinYdcQ, T4SS component 
21ORFJ18568..19800 [+], 1233Putative relaxaseRelaxase, MOBT Family
22ORFI19814..20044 [+], 231putative conjugal transfer protein
23ORFH20049..20606 [+], 558putative conjugal transfer protein
24ORFG20618..21613 [+], 996putative conjugal transfer protein
25ORFF21623..21847 [+], 225putative conjugal transfer protein
26ORFE21850..22260 [+], 411putative conjugal transfer proteinYddD, T4SS component 
27ORFD22274..24778 [+], 2505putative conjugal transfer proteinYddE, T4SS component 
28ORFC24790..26670 [+], 1881putative conjugal transfer proteinYddG, T4SS component 
29ORFB26672..26896 [+], 225putative conjugal transfer protein
30ORFA26913..28025 [+], 1113putative conjugal transfer proteinOrf13_p, T4SS component 
31xis28039..28287 [+], 249Excisionase
32int28287..29633 [+], 1347Tyrosine integraseIntegrase 
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins32Fasta
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PudMed:28432093] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature