ICEberg
I. Information of ICE
ICEberg ID741
Name ICE_SsaB35_rpsI This is a predicted ICE derived from literature
FamilyUnclassified
OrganismStreptococcus salivarius B35
Size (bp)28,407
GC content [Genome] (%)36.05
Insertion siterpsI
Function-
Species that ICE can be transferred to-
Nucleotide SequenceLT622825 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..28407 
Putative oriT region coordinates: 16660..16872;   oriTDB id:  200003
GCCTGACCACAGGTCAGGCGCAGACCGTAGCCCGAAGTTCCTAGGCCATGATGAGACTTCAACCCCCGAT
TTCTAATAGGGGGGTTACATTTGGCAAAAGTGCCACGTCCACCCCTCCTCATTCCTTGTGGGAGTTGGGA
TTTCAGGATTTAGAAAGTGTGTCACTTTGGTCCAAAAAGTGTGTCACTTAATCAAAAGGAGGTGTTCCCA
TGA
Putative relaxase coordinates: 16873..18105; Gene: ORFJ;  Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of ICE_SsaB35_rpsI is not available.



The graph information of ICE_SsaB35_rpsI components from LT622825
Complete gene list of ICE_SsaB35_rpsI from LT622825
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-178..1086 [-], 909hypothetical protein
2-1250..1549 [+], 300hypothetical protein
3mcrC1878..3167 [-], 1290McrBC system restriction component
4mcrB3164..4894 [-], 1731ATPase associated with various cellular activities
5llaJIM24909..6042 [-], 1134Cytosine-specific methyltransferase
6llaJIM16032..7435 [-], 1404Cytosine-specific methyltransferase
7-7521..8381 [-], 861hypothetical protein
8-8416..8709 [-], 294hypothetical protein
9umuD8702..9064 [-], 363Uncharacterized protein
10umuC9061..10476 [-], 1416SOS responce UmuC protein
11arp110480..11160 [-], 681putative transcriptional regulator Arp1
12-11373..11732 [+], 360hypothetical protein
13-11768..12976 [-], 1209hypothetical protein
14arp212976..13314 [-], 339putative transcriptional regulator Arp2
15ORFO13902..13931 [+], 30Conserved protein of unknown function
16ORFN13966..14148 [+], 183Conserved protein of unknown function
17ORFM14187..14483 [+], 297putative conjugal transfer protein
18ORFL14505..14966 [+], 462putative conjugal transfer protein
19ORFK14980..16665 [+], 1686FtsK/SpoIIIE family coupling proteinYdcQ, T4SS component 
20ORFJ16873..18105 [+], 1233putative relaxaseRelaxase, MOBT Family
21ORFI18120..18350 [+], 231putative conjugal transfer protein
22ORFH18355..18912 [+], 558putative conjugal transfer protein
23ORFG18924..19919 [+], 996putative conjugal transfer protein
24ORFF19929..20153 [+], 225putative conjugal transfer protein
25ORFE20156..20566 [+], 411putative conjugal transfer proteinYddD, T4SS component 
26ORFD20580..23084 [+], 2505putative conjugal transfer proteinYddE, T4SS component 
27ORFC23096..24976 [+], 1881putative conjugal transfer proteinYddG, T4SS component 
28ORFB24978..25202 [+], 225putative conjugal transfer protein
29ORFA25219..26331 [+], 1113putative conjugal transfer proteinOrf13_p, T4SS component 
30-26397..26672 [+], 276hypothetical protein
31xis26798..27070 [+], 273excisionase
32int27081..28295 [+], 1215tyrosine integraseIntegrase 
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins32Fasta
(1) Dahmane N; Libante V; Charron-Bourgoin F; Guedon E; Guedon G; Leblond-Bourget N; Payot S (2017). Diversity of Integrative and Conjugative Elements of Streptococcus salivarius and Their Intra- and Interspecies Transfer. Appl Environ Microbiol. 83(13). [PudMed:28432093] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature