ICEberg
I. Information of ICE
ICEberg ID47
Name Tn5251 (part of Tn5253This ICE is derived from experimental literature
FamilyTn916
OrganismStreptococcus pneumoniae DP1322
Size (bp)18033
GC content [Genome] (%)38.85
Insertion siteAT rich regions
FunctionTetracycline resistance
Species that ICE can be transferred toStreptococcus pneumoniae; Streptococcus gordonii; Streptococcus pyogenes; Streptococcus agalactiae;Enterococcus faecalis; Bacillus subtilis
Nucleotide SequenceFJ711160 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..18033 
Putative oriT region coordinates: 15400..15532;   oriTDB id:  200001
GTATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTGTAACCAAAGGATTTT
CTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACGGGGGGTTAAGT
Putative relaxase coordinates: 14184..15389;   Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of Tn5251 (part of Tn5253) is not available.



The graph information of Tn5251 (part of Tn5253) components from FJ711160
Complete gene list of Tn5251 (part of Tn5253) from FJ711160
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-175..1392 [-], 1218integraseIntegrase 
2-1474..1677 [-], 204excisionase
3-1661..1912 [+], 252unknown
4-2138..2368 [-], 231unknown
5-2365..2787 [-], 423putative sigma factor
6-3016..3162 [-], 147unknown
7-3292..3645 [+], 354putative transcriptional regulator
8-3705..3893 [-], 189unknown
9-3991..5910 [-], 1920tetracycline resistance proteinAR 
10-5926..6012 [-], 87tet(M) leader peptide
11-6287..7219 [-], 933unknownOrf13_Tn, T4SS component 
12-7216..8217 [-], 1002putative cell wall hydrolaseOrf14_Tn, T4SS component 
13-8214..10391 [-], 2178unknownOrf15_Tn, T4SS component 
14-10394..12841 [-], 2448type IV secretion protein virB4Orf16_Tn, T4SS component 
15-12825..13331 [-], 507unknownOrf17_Tn, T4SS component 
16-13306..13803 [-], 498antirestriction protein
17-13920..14141 [-], 222unknownOrf19_Tn, T4SS component 
18-14184..15389 [-], 1206relaxaseRelaxase, MOBT Family
19-15567..16952 [-], 1386FtsK-SpoIIIE family proteinOrf21_Tn, T4SS component 
20-16981..17364 [-], 384unknown
21-17383..17697 [-], 315unknown
22-17720..17839 [-], 120unknown
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins22Fasta
(1) Santoro F; Oggioni MR; Pozzi G; Iannelli F (2010). Nucleotide sequence and functional analysis of the tet (M)-carrying conjugative transposon Tn5251 of Streptococcus pneumoniae. FEMS Microbiol Lett. 308(2):150-8. [PudMed:20487027] experimental
(2) Provvedi R; Manganelli R; Pozzi G (1996). Characterization of conjugative transposon Tn5251 of Streptococcus pneumoniae. FEMS Microbiol Lett. 135(2-3):231-6. [PudMed:8595862] experimental
(3) Ayoubi P; Kilic AO; Vijayakumar MN (1991). Tn5253, the pneumococcal omega (cat tet) BM6001 element, is a composite structure of two conjugative transposons, Tn5251 and Tn5252. J Bacteriol. 173(5):1617-22. [PudMed:1847905] experimental
 
experimental experimental literature