ICEberg
I. Information of ICE
ICEberg ID43
Name R391 This ICE is derived from experimental literature
FamilySXT/R391
OrganismProvidencia rettgeri
Size (bp)88532
GC content [Genome] (%)46.48
Insertion siteprfC
FunctionKanamycin and mercury resistance
Species that ICE can be transferred toEscherichia coli; Bacteroides spp.
Nucleotide SequenceAY090559 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..88532 
Putative oriT region coordinates: 5604..5710;   oriTDB id:  200057
TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTAGTTTTGGTTTTTGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 32341..34491;   Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of R391 is not available.



The graph information of R391 components from AY090559
Complete gene list of R391 from AY090559
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-119..442 [-], 324hypothetical protein
2-790..1110 [+], 321hypothetical protein
3-1103..2317 [+], 1215hypothetical protein
4-2528..2728 [+], 201hypothetical protein
5-2745..3986 [-], 1242IntIntegrase 
6-3988..4257 [-], 270hypothetical protein
7-4260..5234 [-], 975hypothetical protein
8-5339..5545 [-], 207hypothetical protein
9-5944..6114 [-], 171hypothetical protein
10-6153..7460 [-], 1308RumBmutagenic DNA repair; [PMID: 7751283; 12193633
11-7429..7878 [-], 450RumAmutagenic DNA repair; [PMID: 7751283; 12193633
12-8406..8723 [-], 318hypothetical proteinORF13; a putative exonuclease involved in UV sensitization; [PMID: 12193633
13-8518..9426 [+], 909hypothetical protein
14-9500..9814 [+], 315hypothetical protein
15-9883..10809 [+], 927hypothetical protein
16-10919..11635 [-], 717transposase tnpIS15[PMID: 12193633
17-11096..11935 [+], 840hypothetical protein
18-11952..12560 [-], 609hypothetical protein
19-12021..12737 [+], 717transposase tnpIS15[PMID: 12193633
20-12877..13692 [+], 816aminoglycoside phospotransferase AphAR 
21-13872..14588 [-], 717transposase tnpIS15[PMID: 12193633
22-14049..14648 [+], 600hypothetical protein
23-14567..15199 [+], 633hypothetical proteinTraU_I, T4SS component 
24-15196..15780 [+], 585hypothetical protein
25-15799..18642 [+], 2844putative ATPase
26-18524..19477 [+], 954hypothetical protein
27-19634..20149 [+], 516hypothetical protein
28-20708..21385 [+], 678putative transposase tnp391A[PMID: 12193633
29-21303..24554 [+], 3252hypothetical protein
30-24554..27238 [+], 2685hypothetical protein
31-27251..29491 [+], 2241putative ATP-dependent Lon protease
32-29535..32186 [+], 2652hypothetical protein
33-32341..34491 [+], 2151TraIRelaxase, MOBH Family
34-34540..36360 [+], 1821TraDTraD_F, T4SS component 
35-36370..36930 [+], 561hypothetical protein
36-36908..37552 [+], 645hypothetical protein
37-37579..38166 [-], 588hypothetical protein
38-38180..38419 [-], 240hypothetical protein
39-38455..38736 [+], 282TraLTraL_F, T4SS component 
40-38967..39359 [+], 393TraETraE_F, T4SS component 
41-39340..40242 [+], 903TraKTraK_F, T4SS component 
42-40242..41531 [+], 1290TraBTraB_F, T4SS component 
43-41528..42178 [+], 651HtdDTraV_F, T4SS component 
44-42175..42561 [+], 387TraATraA_F, T4SS component 
45-42602..42922 [-], 321unknown
46-43099..43365 [-], 267unknown
47-43543..43920 [-], 378hypothetical protein
48-44406..45323 [+], 918putative transposase tnpR391Ba putative transposase; [PMID: 12193633
49-45687..46010 [-], 324hypothetical protein
50-45742..47268 [+], 1527putative sulfate permease
51-46452..46700 [-], 249hypothetical protein
52-47280..48131 [+], 852hypothetical protein
53-48155..48604 [-], 450hypothetical protein
54-48635..49144 [-], 510hypothetical protein
55-49249..49425 [-], 177hypothetical protein
56-49588..50280 [+], 693DsbCTrbB_I, T4SS component 
57-50280..52679 [+], 2400TraCTraC_F, T4SS component 
58-53024..53515 [+], 492TrhFTraF, T4SS component 
59-53523..54650 [+], 1128TraWTraW_F, T4SS component 
60-54634..55662 [+], 1029TraUTraU_F, T4SS component 
61-55665..59357 [+], 3693TraNTraN_F, T4SS component 
62-59951..60613 [+], 663hypothetical protein
63-60704..61306 [-], 603hypothetical protein
64-61662..62000 [+], 339hypothetical protein
65-62016..62435 [+], 420hypothetical protein
66-62515..63333 [+], 819hypothetical protein
67-63621..64637 [+], 1017hypothetical protein
68-64730..65806 [+], 1077hypothetical protein
69-65806..66573 [+], 768hypothetical protein
70-66672..67625 [+], 954hypothetical protein
71-67687..68127 [+], 441unknown
72-68197..69852 [+], 1656hypothetical protein
73-69938..70435 [+], 498hypothetical protein
74-70435..70776 [+], 342hypothetical protein
75-70439..70750 [+], 312hypothetical protein
76-70867..71940 [+], 1074hypothetical protein
77-72030..72737 [+], 708hypothetical protein
78-73088..73630 [+], 543hypothetical protein
79-74368..75312 [+], 945TraFTraF_F, T4SS component 
80-75315..76703 [+], 1389TraHTraH_F, T4SS component 
81-76707..80276 [+], 3570TraGTraG_F, T4SS component 
82-80374..80763 [+], 390MerRregulatory gene of mercury resistance operon; [PMID: 12193633
83-80848..81171 [+], 324MerTstructural gene of mercury resistance operon; [PMID: 12193633
84-81256..81531 [+], 276MerPstructural gene of mercury resistance operon; [PMID: 12193633
85-81541..81954 [+], 414MerCstructural gene of mercury resistance operon; [PMID: 12193633
86-81992..83665 [+], 1674MerAstructural gene of mercury resistance operon; [PMID: 12193633
87-83771..84202 [-], 432hypothetical protein
88-84257..84790 [-], 534hypothetical protein
89-84787..85086 [-], 300hypothetical protein
90-85083..85631 [-], 549hypothetical proteinOrf169_F, T4SS component 
91-85618..86226 [-], 609hypothetical protein
92-86267..87136 [-], 870hypothetical protein
93-87286..87495 [+], 210hypothetical protein
94-87561..88208 [+], 648putative transcriptional regulator
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins94Fasta
(1) Wozniak RA; Fouts DE; Spagnoletti M; Colombo MM; Ceccarelli D; Garriss G; Dery C; Burrus V; Waldor MK (2009). Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PudMed:20041216] in_silico
(2) Garriss G; Waldor MK; Burrus V (2009). Mobile antibiotic resistance encoding elements promote their own diversity. PLoS Genet. 5(12):e1000775. [PudMed:20019796] experimental
(3) Bordeleau E; Brouillette E; Robichaud N; Burrus V (2010). Beyond antibiotic resistance: integrating conjugative elements of the SXT/R391 family that encode novel diguanylate cyclases participate to c-di-GMP signalling in Vibrio cholerae. Environ Microbiol. 12(2):510-23. [PudMed:19888998] experimental
(4) Ceccarelli D; Daccord A; Rene M; Burrus V (2008). Identification of the origin of transfer (oriT) and a new gene required for mobilization of the SXT/R391 family of integrating conjugative elements. J Bacteriol. 190(15):5328-38. [PudMed:18539733] experimental
(5) Taviani E; Ceccarelli D; Lazaro N; Bani S; Cappuccinelli P; Colwell RR; Colombo MM (2008). Environmental Vibrio spp., isolated in Mozambique, contain a polymorphic group of integrative conjugative elements and class 1 integrons. FEMS Microbiol Ecol. 64(1):45-54. [PudMed:18318712] experimental
(6) Marrero J; Waldor MK (2007). Determinants of entry exclusion within Eex and TraG are cytoplasmic. J Bacteriol. 189(17):6469-73. [PudMed:17573467] experimental
(7) O'Halloran JA; McGrath BM; Pembroke JT (2007). The orf4 gene of the enterobacterial ICE, R391, encodes a novel UV-inducible recombination directionality factor, Jef, involved in excision and transfer of the ICE. FEMS Microbiol Lett. 272(1):99-105. [PudMed:17504243] experimental
(8) Marrero J; Waldor MK (2007). The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 189(8):3302-5. [PudMed:17307849] experimental
(9) Mead S; Vaisman A; Valjavec-Gratian M; Karata K; Vandewiele D; Woodgate R (2007). Characterization of polVR391: a Y-family polymerase encoded by rumA'B from the IncJ conjugative transposon, R391. Mol Microbiol. 63(3):797-810. [PudMed:17302804] experimental
(10) Marrero J; Waldor MK (2005). Interactions between inner membrane proteins in donor and recipient cells limit conjugal DNA transfer. Dev Cell. 8(6):963-70. [PudMed:15935784] experimental
(11) McGrath BM; O'Halloran JA; Pembroke JT (2005). Pre-exposure to UV irradiation increases the transfer frequency of the IncJ conjugative transposon-like elements R391, R392, R705, R706, R997 and pMERPH and is recA+ dependent. FEMS Microbiol Lett. 243(2):461-5. [PudMed:15686850] experimental
(12) McGrath BM; Pembroke JT (2004). Detailed analysis of the insertion site of the mobile elements R997, pMERPH, R392, R705 and R391 in E. coli K12. FEMS Microbiol Lett. 237(1):19-26. [PudMed:15268933] experimental
(13) Sabater-Munoz B; van Ham RC; Moya A; Silva FJ; Latorre A (2004). Evolution of the leucine gene cluster in Buchnera aphidicola: insights from chromosomal versions of the cluster. J Bacteriol. 186(9):2646-54. [PudMed:15090505] experimental
(14) Boltner D; Osborn AM (2004). Structural comparison of the integrative and conjugative elements R391, pMERPH, R997, and SXT. Plasmid. 51(1):12-23. [PudMed:14711525] experimental
(15) Boltner D; MacMahon C; Pembroke JT; Strike P; Osborn AM (2002). R391: a conjugative integrating mosaic comprised of phage, plasmid, and transposon elements. J Bacteriol. 184(18):5158-69. [PudMed:12193633] experimental
(16) Hochhut B; Beaber JW; Woodgate R; Waldor MK (2001). Formation of chromosomal tandem arrays of the SXT element and R391, two conjugative chromosomally integrating elements that share an attachment site. J Bacteriol. 183(4):1124-32. [PudMed:11157923] experimental
(17) Murphy DB; Pembroke JT (1999). Monitoring of chromosomal insertions of the IncJ elements R391 and R997 in Escherichia coli K-12. FEMS Microbiol Lett. 174(2):355-61. [PudMed:10339829] experimental
(18) Murphy DB; Pembroke JT (1995). Transfer of the IncJ plasmid R391 to recombination deficient Escherichia coli K12: evidence that R391 behaves as a conjugal transposon. FEMS Microbiol Lett. 134(2-3):153-8. [PudMed:8586262] experimental
(19) Peters SE; Hobman JL; Strike P; Ritchie DA (1991). Novel mercury resistance determinants carried by IncJ plasmids pMERPH and R391. Mol Gen Genet. 228(1-2):294-9. [PudMed:1886614] experimental
 
experimental experimental literature
in_silico in silico analysis literature