ICEberg
I. Information of ICE
ICEberg ID384
Name ICEPaePA14-1 This is a putative ICE identified in this study by Blast
FamilyUnclassified
OrganismPseudomonas aeruginosa UCBPP-PA14
Size (bp)26735
GC content [Genome] (%)61.02[66.29]
Insertion siteGMP synthase
Function-
Species that ICE can be transferred to-
Nucleotide SequenceCP000438 (complete ICE sequence in this genome)
Replicon chromosome (6537648 bp, BioProject:386) [NC_008463]
Genome coordinates1300805..1327539 
Putative oriT region coordinates: 1312524..1312633;   oriTDB id:  100041
CGGGCAGGATGTGTGAAGTAGGCCCACCCGCAAGCGGGTTGTCCTTCTTCACGTCCCCTTATTCGCGCCG
GGGGCGCTCAACGGGGCATCCTGCTCTGCGAGGCTGCCGG
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of ICEPaePA14-1 is not available.



The graph information of ICEPaePA14-1 components from CP000438
Complete gene list of ICEPaePA14-1 from CP000438
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1PA14_152901296452..1297429 [-], 978putative regulatory protein
2guaB1297693..1299162 [+], 1470inosine-5-monophosphate dehydrogenase
3guaA1299242..1300819 [+], 1578GMP synthase
4PA14_153501301126..1302328 [+], 1203putative integraseIntegrase 
5PA14_153601302743..1303723 [-], 981hypothetical protein
6PA14_153701303857..1304084 [-], 228hypothetical protein
7repA1304052..1304930 [+], 879replicative helicase, RepA
8repC1304902..1305789 [+], 888putative replication protein, RepC
9tnpR1306410..1306970 [-], 561putative resolvase, essential for transposition
10PA14_154351307101..1308090 [-], 990hypothetical protein
11merE1308087..1308323 [-], 237mercuric resistance protein MerE
12merD1308320..1308685 [-], 366Mercuric resistence transcriptional repressor protein MerD
13merA1308703..1310388 [-], 1686Mercuric reductase MerA
14merP1310460..1310735 [-], 276Periplasmic mercuric ion binding protein, MerP
15merT1310748..1311098 [-], 351Mercuric transport protein MerT
16merR1311170..1311604 [+], 435Regulatory protein merR
17PA14_154901311858..1312034 [+], 177hypothetical protein
18traK1312074..1312361 [+], 288possible oriT-binding protein, TraK
19traJ1312655..1313026 [+], 372oriT-binding protein, TraJ
20trbJ1313291..1314076 [+], 786mating pair formation protein TrbJTrbJ, T4SS component 
21trbK1314094..1314369 [+], 276possible entry/exclusion protein TrbKTrbK, T4SS component 
22trbL1314366..1315988 [+], 1623putative mating pair formation protein TrbLTrbL, T4SS component 
23PA14_155601316504..1316812 [-], 309hypothetical protein
24PA14_155701317148..1317348 [+], 201hypothetical protein
25PA14_155801317407..1320187 [+], 2781possible Type II restriction enzyme, methylase subunit
26PA14_155901321218..1323335 [+], 2118conserved hypothetical protein
27PA14_156001323328..1324512 [+], 1185conserved hypothetical protein
28PA14_156101324805..1327411 [+], 2607conserved hypothetical protein
29PA14_156201328012..1328974 [+], 963possible dehydrogenase
30PA14_156301328895..1330193 [+], 1299hypothetical protein
31PA14_156501330245..1331201 [-], 957conserved hypothetical protein
32PA14_156601331350..1332345 [+], 996probable oxidoreductase
 
flank Flanking regions
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins25Fasta
Identified as part of this study from CP000438