ICEberg
I. Information of ICE
ICEberg ID37
Name ICEPalBan1 This ICE is derived from experimental literature
FamilySXT/R391
OrganismProvidencia alcalifaciens Ban1
Size (bp)96676
GC content [Genome] (%)47.09
Insertion siteprfC
FunctionAntibiotic resistance genes: floR, strBA, sul2, dfrA1; Toxin-antitoxin system
Species that ICE can be transferred to-
Nucleotide SequenceGQ463139 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..96676 
Putative oriT region coordinates: 5905..6011;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 39381..41531; Locus tag: ICEPALBAN1_0039;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEPalBan1 is not available.



The graph information of ICEPalBan1 components from GQ463139
Complete gene list of ICEPalBan1 from GQ463139
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1ICEPALBAN1_00014..126 [+], 123peptide chain release factor 3 (RF-3)
2ICEPALBAN1_0002616..753 [+], 138conserved domain protein
3ICEPALBAN1_00053046..4287 [-], 1242integraseIntegrase 
4ICEPALBAN1_00064289..4558 [-], 270conserved hypothetical protein
5ICEPALBAN1_00074561..5535 [-], 975conserved hypothetical protein
6ICEPALBAN1_00085631..5798 [+], 168hypothetical protein
7ICEPALBAN1_00096000..6443 [+], 444conserved hypothetical protein
8ICEPALBAN1_00106454..7626 [-], 1173protein UmuC
9ICEPALBAN1_00117910..8503 [+], 594transposase, IS3 family, interruption
10ICEPALBAN1_00128617..11595 [+], 2979transposase
11ICEPALBAN1_001312013..13506 [+], 1494iscr2 transposase
12ICEPALBAN1_001413537..14421 [+], 885conserved hypothetical protein
13ICEPALBAN1_001514638..15852 [+], 1215florfenicol/chloramphenicol resistance proteinAR 
14ICEPALBAN1_001816296..16835 [+], 540truncated transposase
15ICEPALBAN1_001716807..17637 [-], 831streptomycin resistance protein BAR 
16ICEPALBAN1_001917643..18446 [-], 804streptomycin 3''-kinaseAR 
17folP18507..19322 [-], 816dihydropteroate synthaseAR 
18ICEPALBAN1_002119793..21406 [+], 1614TnpA
19ICEPALBAN1_002221749..22018 [-], 270protein UmuC
20ICEPALBAN1_002322026..22475 [-], 450protein UmuD
21ICEPALBAN1_002422474..22626 [+], 153hypothetical protein
22ICEPALBAN1_002523131..24036 [+], 906exonuclease, RNase T and DNA polymerase III
23ICEPALBAN1_002624250..24549 [+], 300conserved hypothetical protein
24ICEPALBAN1_002724867..25790 [+], 924conserved hypothetical protein
25ICEPALBAN1_002825904..28333 [+], 2430N-6 DNA methylase
26ICEPALBAN1_002928333..29643 [+], 1311type I restriction-modification protein
27ICEPALBAN1_003029653..30816 [+], 1164conserved hypothetical protein
28ICEPALBAN1_003130831..33848 [+], 3018type I restriction-modification system restriction subunit
29ICEPALBAN1_003233871..34956 [+], 1086conserved hypothetical protein
30ICEPALBAN1_003334979..35530 [+], 552conserved hypothetical protein
31ICEPALBAN1_003435660..35833 [+], 174conserved hypothetical protein
32ICEPALBAN1_003535835..36203 [+], 369membrane-bound metal-dependent hydrolase
33ICEPALBAN1_003636213..37367 [+], 1155conserved hypothetical protein
34ICEPALBAN1_003737360..38550 [+], 1191conserved hypothetical protein
35ICEPALBAN1_003838551..39264 [+], 714conserved hypothetical protein
36ICEPALBAN1_003939381..41531 [+], 2151conjugative relaxaseRelaxase, MOBH Family
37ICEPALBAN1_004041579..43399 [+], 1821conjugative coupling factorTraD_F, T4SS component 
38ICEPALBAN1_004143409..43969 [+], 561conserved hypothetical protein
39ICEPALBAN1_004243956..44591 [+], 636putative conjugation coupling factor
40ICEPALBAN1_004344617..44895 [-], 279transcriptional regulator, XRE family
41ICEPALBAN1_004444892..45215 [-], 324conserved hypothetical protein
42traL45396..45677 [+], 282type IV conjugative transfer system protein TraLTraL_F, T4SS component 
43ICEPALBAN1_004645674..46300 [+], 627sex pilus assemblyTraE_F, T4SS component 
44ICEPALBAN1_004746284..47180 [+], 897TraKTraK_F, T4SS component 
45ICEPALBAN1_004847183..48472 [+], 1290sex pilus assemblyTraB_F, T4SS component 
46ICEPALBAN1_004948547..49119 [+], 573sex pilus assemblyTraV_F, T4SS component 
47ICEPALBAN1_005049116..49502 [+], 387TraATraA_F, T4SS component 
48ICEPALBAN1_005149573..50514 [+], 942conserved hypothetical protein
49ICEPALBAN1_005250507..51445 [+], 939ync
50ICEPALBAN1_005351577..52269 [+], 693DsbCTrbB_I, T4SS component 
51traC52269..54668 [+], 2400type-IV secretion system protein TraCTraC_F, T4SS component 
52ICEPALBAN1_005554661..55008 [+], 348conserved hypothetical protein
53ICEPALBAN1_005654992..55504 [+], 513conjugation signal peptidaseTraF, T4SS component 
54ICEPALBAN1_005755515..56639 [+], 1125sex pilus assemblyTraW_F, T4SS component 
55ICEPALBAN1_005856623..57651 [+], 1029sex pilus assemblyTraU_F, T4SS component 
56ICEPALBAN1_005957654..61346 [+], 3693mating pair stabilizationTraN_F, T4SS component 
57ICEPALBAN1_006061571..62995 [-], 1425transcriptional regulator containing a DNA-binding HTH domain and an aminotransferase domain
58ICEPALBAN1_006163035..63175 [-], 141hypothetical protein
59ICEPALBAN1_006263190..64068 [+], 879phenazine biosynthesis protein PhzF family
60ICEPALBAN1_006364041..65036 [+], 996protein of unknown function DUF6, transmembrane
61ICEPALBAN1_006465033..65428 [+], 396endoribonuclease L-PSP, putative
62ICEPALBAN1_006565453..65914 [+], 462YbaK/prolyl-tRNA synthetase associated region
63ICEPALBAN1_006665959..66552 [-], 594maltose O-acetyltransferase (maltose transacetylase)
64panB66607..67452 [-], 8463-methyl-2-oxobutanoate hydroxymethyltransferase
65ICEPALBAN1_006867461..68084 [-], 624lysine exporter protein
66ICEPALBAN1_006968213..68665 [+], 453transcriptional regulator
67ICEPALBAN1_007068913..69515 [-], 603conserved hypothetical protein
68ICEPALBAN1_007169883..70209 [+], 327conserved hypothetical protein
69ICEPALBAN1_007270225..70662 [+], 438single-strand binding protein family
70ICEPALBAN1_007370723..71541 [+], 819phage recombination protein Bet
71ICEPALBAN1_007471624..71767 [+], 144hypothetical protein
72ICEPALBAN1_007571828..72844 [+], 1017YqaJ viral recombinase family
73ICEPALBAN1_007673054..74013 [+], 960ATPase associated with various cellular activities, AAA_5
74ICEPALBAN1_007774013..74780 [+], 768conserved hypothetical protein
75ICEPALBAN1_007874879..75832 [+], 954conserved hypothetical protein
76ICEPALBAN1_007975894..76334 [+], 441conserved hypothetical protein
77ICEPALBAN1_008076404..78059 [+], 1656von Willebrand factor, type A
78radC78144..78641 [+], 498DNA repair protein RadC
79ICEPALBAN1_008278641..78982 [+], 342conserved hypothetical protein
80ICEPALBAN1_008379074..80147 [+], 1074phage P4 alpha, zinc-binding domain protein
81ICEPALBAN1_008480237..80944 [+], 708conserved hypothetical protein
82ICEPALBAN1_008681216..81620 [+], 405glyoxalase/bleomycin resistance protein/dioxygenase
83ICEPALBAN1_008581617..82318 [-], 702conserved hypothetical protein
84ICEPALBAN1_008782418..82780 [-], 363conserved hypothetical protein
85ICEPALBAN1_008882851..83261 [-], 411membrane associated protein containing xre-family DNA-binding HTH domain
86ICEPALBAN1_008983459..83884 [-], 426conserved hypothetical protein
87folA83989..84462 [-], 474dihydrofolate reductaseAR 
88ICEPALBAN1_009185680..85820 [-], 141hypothetical protein
89ICEPALBAN1_009385966..86910 [+], 945conserved hypothetical proteinTraF_F, T4SS component 
90ICEPALBAN1_009486913..88301 [+], 1389sex pilus assemblyTraH_F, T4SS component 
91ICEPALBAN1_009588305..91874 [+], 3570sex pilus assemblyTraG_F, T4SS component 
92ICEPALBAN1_009691907..92338 [-], 432EexR2
93ICEPALBAN1_009792396..92929 [-], 534transcriptional activator
94ICEPALBAN1_009892926..93225 [-], 300SetD
95ICEPALBAN1_009993222..93770 [-], 549lytic transglycosylase, catalyticOrf169_F, T4SS component 
96ICEPALBAN1_010093757..94419 [-], 663conserved hypothetical protein
97ICEPALBAN1_010194406..95275 [-], 870conserved hypothetical protein
98ICEPALBAN1_010295331..95582 [-], 252SetQ
99ICEPALBAN1_010395700..96347 [+], 648HTH-type transcriptional regulator for conjugative element R391
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins99Fasta
(1) Wozniak RA; Fouts DE; Spagnoletti M; Colombo MM; Ceccarelli D; Garriss G; Dery C; Burrus V; Waldor MK (2009). Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PudMed:20041216] in_silico
(2) Bordeleau E; Brouillette E; Robichaud N; Burrus V (2010). Beyond antibiotic resistance: integrating conjugative elements of the SXT/R391 family that encode novel diguanylate cyclases participate to c-di-GMP signalling in Vibrio cholerae. Environ Microbiol. 12(2):510-23. [PudMed:19888998] experimental
(3) Marrero J; Waldor MK (2007). The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 189(8):3302-5. [PudMed:17307849] experimental
 
experimental experimental literature
in_silico in silico analysis literature