ICEberg
I. Information of ICE
ICEberg ID36
Name ICEVflInd1 This ICE is derived from experimental literature
FamilySXT/R391
OrganismVibrio fluvialis Ind1
Size (bp)114195
GC content [Genome] (%)47.59
Insertion siteprfC
FunctionAntibiotic resistance genes: dfr18, floR, strBA, sul2; Toxin-antitoxin system
Species that ICE can be transferred to-
Nucleotide SequenceGQ463144 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..114195 
Putative oriT region coordinates: 21141..21247;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase -


II. ICE interaction with IME/CIME/

The Interaction Network among ICE/IME/CIME


Detailed Informatioin of the Interaction Network
# ICE  Inter_Ele [Type] Methods Donors Recipients Exper_Ref 
1ICEVflInd1 MGIVflInd1 [IME] experimentalin trans Vibrio fluvialis; E. coli CAG18439 Escherichia coli 20807202; 23204461

experimental This is an interactioin derived from experimental literature



The graph information of ICEVflInd1 components from GQ463144
Complete gene list of ICEVflInd1 from GQ463144
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1ICEVFLIND1_000120..154 [+], 135ribosome-binding factor A
2ICEVFLIND1_0002154..1092 [+], 939tRNA pseudouridine synthase B
3rpsO1234..1503 [+], 270ribosomal protein S15
4pnp1866..3992 [+], 2127polyribonucleotide nucleotidyltransferase
5ICEVFLIND1_00054026..4169 [-], 144hypothetical protein
6ICEVFLIND1_00085086..5526 [+], 441transcriptional regulator, MarR family
7ICEVFLIND1_00095569..6906 [+], 1338multidrug resistance pump
8yhbV6965..7843 [-], 879peptidase, U32 family
9ICEVFLIND1_00117855..8868 [-], 1014STM-proteaseA
10ICEVFLIND1_001411036..11563 [+], 528sterol binding protein
11ICEVFLIND1_001511547..12050 [+], 504acetyltransferase, gnat family
12ICEVFLIND1_001612191..12568 [+], 378DNA polymerase III, psi subunit
13rimI12565..13014 [+], 450ribosomal-protein-alanine acetyltransferase
14ICEVFLIND1_001713003..15060 [-], 2058ggdef domain protein
15ICEVFLIND1_001915852..15989 [+], 138conserved domain protein
16ICEVFLIND1_002218282..19523 [-], 1242integraseIntegrase 
17ICEVFLIND1_002319525..19794 [-], 270conserved hypothetical protein
18ICEVFLIND1_002419797..20771 [-], 975conserved hypothetical protein
19ICEVFLIND1_002520867..21034 [+], 168hypothetical protein
20ICEVFLIND1_002621079..21213 [+], 135hypothetical protein
21ICEVFLIND1_002721236..21679 [+], 444conserved hypothetical protein
22ICEVFLIND1_002821690..22862 [-], 1173protein UmuC
23ICEVFLIND1_002923146..23739 [+], 594transposase, IS3 family, interruption
24ICEVFLIND1_003023853..26831 [+], 2979transposase
25ICEVFLIND1_003127249..28742 [+], 1494iscr2 transposase
26ICEVFLIND1_003228970..29113 [-], 144hypothetical protein
27folA29103..29657 [-], 555dihydrofolate reductase
28ICEVFLIND1_003429671..30156 [-], 486conserved hypothetical protein
29ICEVFLIND1_003530216..31382 [-], 1167conserved hypothetical protein
30dcd31397..32023 [-], 627deoxycytidine triphosphate deaminase
31ICEVFLIND1_003732316..32717 [+], 402transposase
32ICEVFLIND1_003933826..35040 [+], 1215florfenicol/chloramphenicol resistance proteinAR 
33ICEVFLIND1_004035068..35373 [+], 306truncated helix-turn-helix multiple antibiotic resistance protein
34ICEVFLIND1_004235485..36024 [+], 540truncated transposase
35ICEVFLIND1_004135996..36826 [-], 831streptomycin phosphotransferase BAR 
36ICEVFLIND1_004336832..37635 [-], 804streptomycin 3''-kinaseAR 
37folP37696..38511 [-], 816dihydropteroate synthaseAR 
38ICEVFLIND1_004538982..40355 [+], 1374transposase Tn3 family protein
39ICEVFLIND1_004640940..41209 [-], 270protein UmuC
40ICEVFLIND1_004741217..41666 [-], 450protein UmuD
41ICEVFLIND1_004841780..41923 [+], 144hypothetical protein
42ICEVFLIND1_004942170..42328 [-], 159hypothetical protein
43ICEVFLIND1_005042307..43212 [+], 906exonuclease, RNase T and DNA polymerase III
44ICEVFLIND1_005143300..43599 [+], 300conserved hypothetical protein
45ICEVFLIND1_005243917..44840 [+], 924conserved hypothetical protein
46ICEVFLIND1_005344954..47383 [+], 2430N-6 DNA methylase
47ICEVFLIND1_005447383..48552 [+], 1170restriction modification system DNA specificity domain
48ICEVFLIND1_005548563..49720 [+], 1158conserved hypothetical protein
49ICEVFLIND1_005851591..51719 [+], 129conjugative relaxase
50ICEVFLIND1_005951768..53153 [+], 1386conjugative coupling factorTraD_F, T4SS component 
51ICEVFLIND1_006053304..53420 [+], 117hypothetical protein
52ICEVFLIND1_006153436..54953 [+], 1518putative transposase for insertion sequence
53ICEVFLIND1_006254977..55672 [+], 696conserved hypothetical protein
54ICEVFLIND1_006355733..56443 [+], 711transposition helper protein
55ICEVFLIND1_006456480..57043 [-], 564conserved hypothetical protein
56traL57332..57613 [+], 282type IV conjugative transfer system protein TraLTraL_F, T4SS component 
57ICEVFLIND1_006657610..58236 [+], 627sex pilus assemblyTraE_F, T4SS component 
58ICEVFLIND1_006758220..59116 [+], 897TraKTraK_F, T4SS component 
59ICEVFLIND1_007060491..61051 [+], 561sex pilus assemblyTraV_F, T4SS component 
60ICEVFLIND1_007161048..61434 [+], 387putative pilin subunitTraA_F, T4SS component 
61ICEVFLIND1_007261612..62445 [+], 834conserved hypothetical protein
62ICEVFLIND1_007563506..64198 [+], 693DsbCTrbB_I, T4SS component 
63traC64198..66597 [+], 2400type-IV secretion system protein TraCTraC_F, T4SS component 
64ICEVFLIND1_007766656..66937 [+], 282conserved hypothetical protein
65ICEVFLIND1_007866921..67433 [+], 513conjugation signal peptidaseTraF, T4SS component 
66ICEVFLIND1_007967444..68568 [+], 1125sex pilus assemblyTraW_F, T4SS component 
67ICEVFLIND1_008068546..69580 [+], 1035conjugal transfer protein TraU, putativeTraU_F, T4SS component 
68ICEVFLIND1_008169583..73275 [+], 3693mating pair stabilizationTraN_F, T4SS component 
69ICEVFLIND1_008273506..73838 [+], 333hypothetical protein
70ICEVFLIND1_008373869..74531 [+], 663conserved hypothetical protein
71ICEVFLIND1_008474622..75224 [-], 603conserved hypothetical protein
72ICEVFLIND1_008575634..75918 [+], 285conserved hypothetical protein
73ICEVFLIND1_008675934..76353 [+], 420single-strand binding protein family
74ICEVFLIND1_008776433..77251 [+], 819phage recombination protein Bet
75ICEVFLIND1_008877333..77476 [+], 144hypothetical protein
76ICEVFLIND1_008977537..78553 [+], 1017YqaJ viral recombinase family
77ICEVFLIND1_009078763..79722 [+], 960ATPase associated with various cellular activities, AAA_5
78ICEVFLIND1_009179722..80489 [+], 768conserved hypothetical protein
79ICEVFLIND1_009280588..81541 [+], 954conserved hypothetical protein
80ICEVFLIND1_009381603..82043 [+], 441conserved hypothetical protein
81ICEVFLIND1_009482113..83768 [+], 1656von Willebrand factor, type A
82ICEVFLIND1_009583851..84348 [+], 498DNA repair protein RadC
83ICEVFLIND1_009684348..84689 [+], 342conserved hypothetical protein
84ICEVFLIND1_009784781..85854 [+], 1074phage P4 alpha, zinc-binding domain protein
85ICEVFLIND1_009885947..86651 [+], 705conserved hypothetical protein
86ICEVFLIND1_009986674..86799 [+], 126hypothetical protein
87ICEVFLIND1_010086768..87520 [+], 753conserved hypothetical protein
88ICEVFLIND1_010187575..88006 [-], 432conserved hypothetical protein
89ICEVFLIND1_010288044..88163 [+], 120hypothetical protein
90ICEVFLIND1_010388472..89743 [+], 1272pas/pac/ggdef-domain containing protein
91ICEVFLIND1_010489917..90342 [+], 426integrase, catalytic region
92ICEVFLIND1_010590503..91432 [-], 930response regulator receiver protein
93ICEVFLIND1_010691438..95196 [-], 3759multi-sensor hybrid histidine kinase
94ICEVFLIND1_010795245..95361 [-], 117hypothetical protein
95ICEVFLIND1_010895680..95838 [+], 159hypothetical protein
96ICEVFLIND1_010995984..96928 [+], 945conserved hypothetical proteinTraF_F, T4SS component 
97ICEVFLIND1_011096931..98319 [+], 1389TraH family proteinTraH_F, T4SS component 
98ICEVFLIND1_011198323..101892 [+], 3570sex pilus assemblyTraG_F, T4SS component 
99ICEVFLIND1_0112101925..102380 [-], 456EexS1
100ICEVFLIND1_0113102414..102947 [-], 534transcriptional activator
101ICEVFLIND1_0114102944..103243 [-], 300transcriptional activator
102ICEVFLIND1_0115103240..103788 [-], 549lytic transglycosylase, catalyticOrf169_F, T4SS component 
103ICEVFLIND1_0116103775..104437 [-], 663conserved hypothetical protein
104ICEVFLIND1_0117104424..105293 [-], 870conserved hypothetical protein
105ICEVFLIND1_0118105349..105600 [-], 252conserved hypothetical protein
106ICEVFLIND1_0119105718..106365 [+], 648HTH-type transcriptional regulator for conjugative element R391
107prfC106622..108211 [+], 1590peptide chain release factor 3
108ICEVFLIND1_0121108333..109604 [-], 1272ATP-dependent RNA helicase SrmB
109ICEVFLIND1_0122109692..110414 [-], 723methyltransferase
110brnQ110723..112036 [+], 1314branched-chain amino acid transport system II carrier protein
111ICEVFLIND1_0125113335..114195 [+], 861lysyl-tRNA synthetase (Lysine--tRNA ligase) (LysRS)
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins111Fasta
(1) Daccord A; Mursell M; Poulin-Laprade D; Burrus V (2012). Dynamics of the SetCD-Regulated Integration and Excision of Genomic Islands Mobilized by Integrating Conjugative Elements of the SXT/R391 Family. J Bacteriol. 194(21):5794-802. [PudMed:22923590] experimental
(2) Daccord A; Ceccarelli D; Burrus V (2010). Integrating conjugative elements of the SXT/R391 family trigger the excision and drive the mobilization of a new class of Vibrio genomic islands. Mol Microbiol. 78(3):576-88. [PudMed:20807202] experimental
(3) Wozniak RA; Fouts DE; Spagnoletti M; Colombo MM; Ceccarelli D; Garriss G; Dery C; Burrus V; Waldor MK (2009). Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PudMed:20041216] in_silico
(4) Bordeleau E; Brouillette E; Robichaud N; Burrus V (2010). Beyond antibiotic resistance: integrating conjugative elements of the SXT/R391 family that encode novel diguanylate cyclases participate to c-di-GMP signalling in Vibrio cholerae. Environ Microbiol. 12(2):510-23. [PudMed:19888998] experimental
(5) Marrero J; Waldor MK (2007). The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 189(8):3302-5. [PudMed:17307849] experimental
 
experimental experimental literature
in_silico in silico analysis literature