ICEberg
I. Information of ICE
ICEberg ID328
Name Tn6084 This ICE is derived from experimental literature
FamilyTn916
OrganismEnterococcus faecium C68
Size (bp)22312
GC content [Genome] (%)38.42
Insertion siteAT rich regions
FunctionResistance to tetracycline and minocycline
Species that ICE can be transferred to-
Nucleotide SequenceHM243622 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates34197..56508 
Putative oriT region coordinates: 36697..36829;   oriTDB id:  200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of Tn6084 is not available.

 

The gene information of Tn6084 is not available.
ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins0Fasta
-