ICEberg
I. Information of ICE
ICEberg ID323
Name ICECdiM120-1 This is a putative ICE identified in this study by Blast
FamilyTn916
OrganismClostridium difficile M120
Size (bp)17902
GC content [Genome] (%)38.82[28.67]
Insertion siteAT rich regions
Function-
Species that ICE can be transferred to-
Nucleotide SequenceFN665653 (complete ICE sequence in this genome)
Replicon[FN665653]
Genome coordinates2171649..2189550 
Putative oriT region coordinates: 2186918..2187050;   oriTDB id:  200001
GTATGTCAACTTTTAAAGCCCATTTGACATACGCTGAAATTTTGTAAATCCCTTGTAACCAAAGGATTTT
CTAATGTTTTTTTGACTGTTTCCTGTCGATTTGTACCCCCCTGTTAGATACGGGGGGTTAAGT
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of ICECdiM120-1 is not available.

 

The gene information of ICECdiM120-1 is not available.
ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins0Fasta
Identified as part of this study from FN665653