ICEberg
I. Information of ICE
ICEberg ID321
Name Tn6003 This ICE is derived from experimental literature
FamilyTn916
OrganismStreptococcus pneumoniae Ar4
Size (bp)25101
GC content [Genome] (%)37.98
Insertion siteAT rich regions
FunctionErythromycin, aminoglycoside, streptothricin and tetracycline resistance
Species that ICE can be transferred to-
Nucleotide SequenceAM410044 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..25101 
Putative oriT region coordinates: 2501..2633;   oriTDB id:  200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase coordinates: 2860..4062;   Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of Tn6003 is not available.



The graph information of Tn6003 components from AM410044
Complete gene list of Tn6003 from AM410044
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-194..283 [+], 90truncated hypothetical protein
2-336..650 [+], 315hypothetical protein
3-666..1052 [+], 387hypothetical protein
4-1081..2466 [+], 1386hypothetical proteinOrf21_Tn, T4SS component 
5-2860..4062 [+], 1203hypothetical proteinRelaxase, MOBT Family
6-3895..4062 [+], 168MLS leader peptide
7ORFM04111..4194 [+], 84MLS leader peptide
8ermB4319..5104 [+], 786-
9aadE5107..5445 [+], 339adenyltransferase
10sat45454..5984 [+], 531streptothricin acetyltransferase
11aphA-36077..6871 [+], 795aminoglycoside phosphotransferase type IIIAR 
12-7147..7719 [+], 573hypothetical protein
13-8336..8419 [+], 84MLS leader peptide
14ermB8544..9281 [+], 738MLS methylaseAR 
15-9226..9417 [+], 192hypothetical protein
16-9538..10785 [-], 1248putative transposase
17-10965..11186 [+], 222hypothetical proteinOrf19_Tn, T4SS component 
18-11303..11800 [+], 498hypothetical protein
19-11775..12281 [+], 507hypothetical proteinOrf17_Tn, T4SS component 
20-12265..14712 [+], 2448hypothetical proteinOrf16_Tn, T4SS component 
21-14715..16892 [+], 2178hypothetical proteinOrf15_Tn, T4SS component 
22-16889..17674 [+], 786hypothetical proteinOrf14_Tn, T4SS component 
23-17887..18819 [+], 933hypothetical proteinOrf13_Tn, T4SS component 
24-19094..19180 [+], 87tet(M) leader peptide
25tet(M)19181..21113 [+], 1933-
26-21211..21399 [+], 189hypothetical protein
27-21459..21812 [-], 354hypothetical protein
28-22017..22088 [+], 72hypothetical protein
29-22266..22739 [+], 474hypothetical protein
30-22736..22966 [+], 231hypothetical protein
31-23187..23441 [-], 255hypothetical protein
32Xis-Tn23425..23628 [+], 204excisionase
33Int-Tn23710..24927 [+], 1218integraseIntegrase 
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins31Fasta
(1) Cochetti I; Tili E; Vecchi M; Manzin A; Mingoia M; Varaldo PE; Montanari MP (2007). New Tn916-related elements causing erm(B)-mediated erythromycin resistance in tetracycline-susceptible pneumococci. J Antimicrob Chemother. 60(1):127-31. [PudMed:17483548] experimental
 
experimental experimental literature