ICEberg
I. Information of ICE
ICEberg ID318
Name Tn6085This ICE is derived from experimental literature
FamilyTn916
OrganismEnterococcus faecium C68
Size (bp)20790
GC content [Genome] (%)38.46
Insertion siteAT rich regions
Functionresistance to tetracycline and minocycline
Species that ICE can be transferred to-
Nucleotide SequenceHM243623 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates12581..33370 
Putative oriT region coordinates: 15081..15213;   oriTDB id:  200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of Tn6085b is not available.

 

The gene information of Tn6085b is not available.
ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins0Fasta
(1) Rice LB; Carias LL; Rudin S; Hutton RA; Marshall S (2010). Multiple copies of functional, Tet(M)-encoding Tn916-like elements in a clinical Enterococcus faecium isolate. Plasmid. 64(3):150-5. [PudMed:20600284] experimental
 
experimental experimental literature