ICEberg
I. Information of ICE
ICEberg ID307
Name Tn916(RST11) This ICE is derived from experimental literature
FamilyTn916
OrganismStaphylococcus rostri RST11
Size (bp)18032
GC content [Genome] (%)38.7
Insertion siteAT rich regions
Functiontetracycline resistance
Species that ICE can be transferred to-
Nucleotide SequenceFN550102 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..18032 
Putative oriT region coordinates: 2501..2633;   oriTDB id:  200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase coordinates: 2860..3849;   Family:  MOBT


II. ICE interaction with IME/CIME/

The interaction information of Tn916(RST11) is not available.



The graph information of Tn916(RST11) components from FN550102
Complete gene list of Tn916(RST11) from FN550102
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-194..313 [+], 120hypothetical protein
2-336..650 [+], 315conjugative transposon protein
3-666..1052 [+], 387conjugative transposon protein
4-1081..2466 [+], 1386hypothetical proteinOrf21_Tn, T4SS component 
5-2860..3849 [+], 990putative transcriptional regulatorRelaxase, MOBT Family
6-3892..4113 [+], 222conjugative transposon proteinOrf19_Tn, T4SS component 
7-4230..4727 [+], 498conjugative transposon protein
8-4702..5208 [+], 507conjugative transposon proteinOrf17_Tn, T4SS component 
9-5192..7639 [+], 2448putative regulatory proteinOrf16_Tn, T4SS component 
10-7642..9819 [+], 2178putative membrane proteinOrf15_Tn, T4SS component 
11-9816..10817 [+], 1002putative membrane proteinOrf14_Tn, T4SS component 
12-10814..11746 [+], 933putative membrane proteinOrf13_Tn, T4SS component 
13-12021..12107 [+], 87tetM leader peptide
14tetM12108..14042 [+], 1935tetracycline resistance proteinAR 
15-14140..14328 [+], 189putative transcriptional regulator
16-14388..14741 [+], 354-
17-14946..15017 [+], 72putative ATP-binding protein
18-15195..15668 [+], 474putative regulatory protein
19-15665..15895 [+], 231putative ATP-binding protein
20-16121..16372 [-], 252excisionase
21Xis-Tn16356..16559 [+], 204excisionase
22Int-Tn16641..17858 [+], 1218transposaseIntegrase 
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins21Fasta
(1) Stegmann R et al. (2010). Antibiotic resistance profile of Staphylococcus rostri, a new species isolated from healthy pigs. Vet Microbiol. 145(1-2). [PudMed:20399039] experimental
 
experimental experimental literature