ICEberg
I. Information of ICE
ICEberg ID303
Name Tn916(pAM120) This ICE is derived from experimental literature
FamilyTn916
OrganismCloning vector pAM120
Size (bp)18032
GC content [Genome] (%)38.75[38.53]
Insertion siteAT rich regions
Functiontetracycline resistance
Species that ICE can be transferred to-
Nucleotide SequenceU49939 (complete ICE sequence in this genome)
Replicon[U49939]
Genome coordinates1344..19375 
Putative oriT region coordinates: 3844..3976;   oriTDB id:  200001
ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC
TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of Tn916(pAM120) is not available.



The graph information of Tn916(pAM120) components from U49939
Complete gene list of Tn916(pAM120) from U49939
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-13466..15385 [+], 1920tetracycline resistance proteinAR 
2-22297..23157 [-], 861beta-lactamase
 
flank Flanking regions
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins1Fasta
(1) Gawron-Burke C; Clewell DB (1984). Regeneration of insertionally inactivated streptococcal DNA fragments after excision of transposon Tn916 in Escherichia coli: strategy for targeting and cloning of genes from gram-positive bacteria. J Bacteriol. 159(1):214-21. [PudMed:6330031] experimental
(2) Clewell DB; Flannagan SE; Ike Y; Jones JM; Gawron-Burke C (1988). Sequence analysis of termini of conjugative transposon Tn916. J Bacteriol. 170(7):3046-52. [PudMed:2838457] experimental
 
experimental experimental literature