ICEberg
I. Information of ICE
ICEberg ID23
Name ICEVchMex1 This ICE is derived from experimental literature
FamilySXT/R391
OrganismVibrio cholerae non O1-O139 Mex1
Size (bp)83194
GC content [Genome] (%)46.73
Insertion siteprfC
FunctionResistant to ampicillin; restriction modification system
Species that ICE can be transferred to-
Nucleotide SequenceGQ463143 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..83194 
Putative oriT region coordinates: 5686..5792;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 19499..21649; Locus tag: ICEVCHMEX1_0020;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEVchMex1 is not available.



The graph information of ICEVchMex1 components from GQ463143
Complete gene list of ICEVchMex1 from GQ463143
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1ICEVCHMEX1_0001872..1192 [+], 321transcriptional regulator, XRE family
2ICEVCHMEX1_00021185..2399 [+], 1215HipA domain protein
3ICEVCHMEX1_00032616..2810 [+], 195conserved domain protein
4ICEVCHMEX1_00042827..4068 [-], 1242integraseIntegrase 
5ICEVCHMEX1_00054070..4339 [-], 270conserved hypothetical protein
6ICEVCHMEX1_00064342..5316 [-], 975conserved hypothetical protein
7ICEVCHMEX1_00075412..5579 [+], 168hypothetical protein
8ICEVCHMEX1_00085781..6224 [+], 444conserved hypothetical protein
9ICEVCHMEX1_00096235..7554 [-], 1320protein UmuC
10ICEVCHMEX1_00107511..7960 [-], 450protein UmuD
11ICEVCHMEX1_00118600..9505 [+], 906exonuclease, RNase T and DNA polymerase III
12ICEVCHMEX1_00129719..10018 [+], 300conserved hypothetical protein
13ICEVCHMEX1_001310336..11259 [+], 924conserved hypothetical protein
14hsdM11329..12903 [+], 1575type I restriction-modification system, M subunit
15ICEVCHMEX1_001512900..14222 [+], 1323specificity subunit
16ICEVCHMEX1_001614311..15312 [+], 1002filamentation induced by cAMP protein Fic
17ICEVCHMEX1_001715376..18489 [+], 3114type I site-specific deoxyribonuclease, R subunit
18ICEVCHMEX1_002019499..21649 [+], 2151conjugative relaxaseRelaxase, MOBH Family
19ICEVCHMEX1_002121698..23518 [+], 1821conjugative coupling factorTraD_F, T4SS component 
20ICEVCHMEX1_002223528..24088 [+], 561conserved hypothetical protein
21ICEVCHMEX1_002324075..24710 [+], 636putative conjugation coupling factor
22ICEVCHMEX1_002424848..25954 [+], 1107filamentation induced by cAMP protein Fic
23traL26144..26425 [+], 282type IV conjugative transfer system protein TraLTraL_F, T4SS component 
24ICEVCHMEX1_002626422..27048 [+], 627sex pilus assemblyTraE_F, T4SS component 
25ICEVCHMEX1_002727032..27931 [+], 900TraKTraK_F, T4SS component 
26ICEVCHMEX1_002827931..29220 [+], 1290sex pilus assemblyTraB_F, T4SS component 
27ICEVCHMEX1_002929295..29867 [+], 573sex pilus assemblyTraV_F, T4SS component 
28ICEVCHMEX1_003029864..30250 [+], 387TraATraA_F, T4SS component 
29ICEVCHMEX1_003130291..30797 [-], 507acetyltransferase, gnat family
30ICEVCHMEX1_003230788..31054 [-], 267conserved hypothetical protein
31ICEVCHMEX1_003331209..31634 [-], 426conserved hypothetical protein
32ICEVCHMEX1_003532567..33361 [+], 795aminoglycoside 3'-phosphotransferase
33ICEVCHMEX1_003633571..34263 [+], 693DsbCTrbB_I, T4SS component 
34traC34264..36663 [+], 2400type-IV secretion system protein TraCTraC_F, T4SS component 
35ICEVCHMEX1_003836656..37003 [+], 348conserved hypothetical protein
36ICEVCHMEX1_003936987..37499 [+], 513conjugation signal peptidaseTraF, T4SS component 
37ICEVCHMEX1_004138618..39646 [+], 1029sex pilus assemblyTraU_F, T4SS component 
38ICEVCHMEX1_004239649..43341 [+], 3693mating pair stabilizationTraN_F, T4SS component 
39ICEVCHMEX1_004443354..43497 [+], 144hypothetical protein
40ICEVCHMEX1_004343483..45159 [-], 1677UvrD/REP helicase
41ICEVCHMEX1_004545156..47081 [-], 1926ATP-dependent endonuclease of the OLD family
42ICEVCHMEX1_004647159..49537 [-], 2379peptidase, S8A
43ICEVCHMEX1_004749553..50524 [-], 972ATPase, AAA family
44ICEVCHMEX1_004850635..50814 [-], 180conserved hypothetical protein
45ICEVCHMEX1_004950948..51550 [-], 603conserved hypothetical protein
46ICEVCHMEX1_005051918..52244 [+], 327conserved hypothetical protein
47ICEVCHMEX1_005152260..52679 [+], 420single-strand binding protein family
48ICEVCHMEX1_005252759..53577 [+], 819phage recombination protein Bet
49ICEVCHMEX1_005353659..53802 [+], 144hypothetical protein
50ICEVCHMEX1_005453864..54880 [+], 1017YqaJ viral recombinase family
51ICEVCHMEX1_005555090..56049 [+], 960ATPase associated with various cellular activities, AAA_5
52ICEVCHMEX1_005656049..56816 [+], 768conserved hypothetical protein
53ICEVCHMEX1_005756915..57868 [+], 954conserved hypothetical protein
54ICEVCHMEX1_005857930..58370 [+], 441conserved hypothetical protein
55ICEVCHMEX1_005958440..60095 [+], 1656von Willebrand factor, type A
56radC60178..60675 [+], 498DNA repair protein RadC
57ICEVCHMEX1_006160675..61016 [+], 342conserved hypothetical protein
58ICEVCHMEX1_006261108..62181 [+], 1074phage P4 alpha, zinc-binding domain protein
59ICEVCHMEX1_006362271..62978 [+], 708conserved hypothetical protein
60ICEVCHMEX1_006463001..63126 [+], 126hypothetical protein
61ICEVCHMEX1_006563095..63847 [+], 753conserved hypothetical protein
62ICEVCHMEX1_006663902..64438 [-], 537conserved hypothetical protein
63ICEVCHMEX1_006764799..66070 [+], 1272pas/pac/ggdef-domain containing protein
64ICEVCHMEX1_006866244..66669 [+], 426integrase, catalytic region
65ICEVCHMEX1_006966830..67759 [-], 930response regulator receiver protein
66ICEVCHMEX1_007067765..71571 [-], 3807multi-sensor hybrid histidine kinase
67ICEVCHMEX1_007171572..71688 [-], 117hypothetical protein
68ICEVCHMEX1_007272019..72165 [+], 147hypothetical protein
69ICEVCHMEX1_007372311..73255 [+], 945conserved hypothetical proteinTraF_F, T4SS component 
70ICEVCHMEX1_007473258..74646 [+], 1389sex pilus assemblyTraH_F, T4SS component 
71ICEVCHMEX1_007574650..78219 [+], 3570sex pilus assemblyTraG_F, T4SS component 
72ICEVCHMEX1_007678252..78683 [-], 432EexR3
73ICEVCHMEX1_007778741..79274 [-], 534transcriptional activator
74ICEVCHMEX1_007879271..79570 [-], 300SetD
75ICEVCHMEX1_008380759..81628 [-], 870conserved hypothetical protein
76ICEVCHMEX1_008481684..81935 [-], 252SetQ
77ICEVCHMEX1_008582053..82700 [+], 648HTH-type transcriptional regulator for conjugative element R391
78ICEVCHMEX1_008682957..83194 [+], 238peptide termination factor
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins78Fasta
(1) Wozniak RA; Fouts DE; Spagnoletti M; Colombo MM; Ceccarelli D; Garriss G; Dery C; Burrus V; Waldor MK (2009). Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PudMed:20041216] in_silico
(2) Bordeleau E; Brouillette E; Robichaud N; Burrus V (2010). Beyond antibiotic resistance: integrating conjugative elements of the SXT/R391 family that encode novel diguanylate cyclases participate to c-di-GMP signalling in Vibrio cholerae. Environ Microbiol. 12(2):510-23. [PudMed:19888998] experimental
(3) Marrero J; Waldor MK (2007). The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 189(8):3302-5. [PudMed:17307849] experimental
(4) Burrus V; Quezada-Calvillo R; Marrero J; Waldor MK (2006). SXT-related integrating conjugative element in New World Vibrio cholerae. Appl Environ Microbiol. 72(4):3054-7. [PudMed:16598018] experimental
 
experimental experimental literature
in_silico in silico analysis literature