ICEberg
I. Information of ICE
ICEberg ID22
Name ICEVchInd5 [ICEVchHai1] This ICE is derived from experimental literature
FamilySXT/R391
OrganismVibrio cholerae O1 Ind5
Size (bp)97952
GC content [Genome] (%)46.73
Insertion siteprfC
FunctionAntibiotic resistance genes: floR, strBA, sul2, dfrA1; glyoxoylase abx resistance
Species that ICE can be transferred to-
Nucleotide SequenceGQ463142 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..97952 
Putative oriT region coordinates: 5906..6012;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 41932..44082; Locus tag: ICEVCHIND5_0038;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEVchInd5 [ICEVchHai1] is not available.



The graph information of ICEVchInd5 [ICEVchHai1] components from GQ463142
Complete gene list of ICEVchInd5 [ICEVchHai1] from GQ463142
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1ICEVCHIND5_0001565..753 [+], 189conserved domain protein
2ICEVCHIND5_0002899..2917 [+], 2019putative DNA mismatch repair protein
3ICEVCHIND5_00033047..4288 [-], 1242integraseIntegrase 
4ICEVCHIND5_00044290..4559 [-], 270conserved hypothetical protein
5ICEVCHIND5_00054562..5536 [-], 975conserved hypothetical protein
6ICEVCHIND5_00065632..5799 [+], 168hypothetical protein
7ICEVCHIND5_00075844..5978 [+], 135hypothetical protein
8ICEVCHIND5_00086001..6444 [+], 444conserved hypothetical protein
9ICEVCHIND5_00096455..7627 [-], 1173protein UmuC
10ICEVCHIND5_00107911..8504 [+], 594transposase, IS3 family, interruption
11ICEVCHIND5_00118618..11596 [+], 2979transposase
12ICEVCHIND5_001212014..13507 [+], 1494iscr2 transposase
13ICEVCHIND5_001313538..14422 [+], 885conserved hypothetical protein
14ICEVCHIND5_001414639..15853 [+], 1215florfenicol/chloramphenicol resistance proteinAR 
15ICEVCHIND5_001515908..16186 [+], 279truncated helix-turn-helix multiple antibiotic resistance protein
16ICEVCHIND5_001716298..16837 [+], 540truncated transposase
17ICEVCHIND5_001616809..17639 [-], 831streptomycin resistance protein BAR 
18ICEVCHIND5_001817645..18448 [-], 804streptomycin 3''-kinaseAR 
19folP18509..19324 [-], 816dihydropteroate synthaseAR 
20ICEVCHIND5_002119795..21147 [+], 1353TnpA
21ICEVCHIND5_002021139..22350 [-], 1212transposase, Mutator family
22ICEVCHIND5_002222408..22911 [-], 504MutL protein
23ICEVCHIND5_002323064..23333 [-], 270ultraviolet light resistance protein B
24ICEVCHIND5_002423341..23790 [-], 450protein UmuD
25ICEVCHIND5_002523909..24046 [+], 138hypothetical protein
26ICEVCHIND5_002624430..25335 [+], 906exonuclease, RNase T and DNA polymerase III
27ICEVCHIND5_002725423..25722 [+], 300conserved hypothetical protein
28ICEVCHIND5_002826040..26960 [+], 921conserved hypothetical protein
29ICEVCHIND5_002926978..27778 [+], 801hypothetical protein
30ICEVCHIND5_003027762..28310 [+], 549conserved hypothetical protein
31ICEVCHIND5_003128323..32012 [+], 3690conserved hypothetical protein
32ICEVCHIND5_003232017..35757 [+], 3741conserved hypothetical protein
33ICEVCHIND5_003335770..38073 [+], 2304PglZ domain family
34ICEVCHIND5_003438112..40163 [+], 2052conserved hypothetical protein
35ICEVCHIND5_003540190..40960 [+], 771conserved hypothetical protein
36ICEVCHIND5_003740995..41810 [+], 816conserved hypothetical protein
37ICEVCHIND5_003641787..41909 [-], 123hypothetical protein
38ICEVCHIND5_003841932..44082 [+], 2151conjugative relaxaseRelaxase, MOBH Family
39ICEVCHIND5_003944131..45951 [+], 1821conjugative coupling factorTraD_F, T4SS component 
40ICEVCHIND5_004045961..46521 [+], 561conserved hypothetical protein
41ICEVCHIND5_004146508..47143 [+], 636putative conjugation coupling factor
42ICEVCHIND5_004247170..47757 [-], 588conserved hypothetical protein
43traL48046..48327 [+], 282type IV conjugative transfer system protein TraLTraL_F, T4SS component 
44ICEVCHIND5_004448324..48950 [+], 627sex pilus assemblyTraE_F, T4SS component 
45ICEVCHIND5_004548934..49830 [+], 897TraKTraK_F, T4SS component 
46ICEVCHIND5_004649833..51122 [+], 1290sex pilus assemblyTraB_F, T4SS component 
47ICEVCHIND5_004751119..51769 [+], 651sex pilus assemblyTraV_F, T4SS component 
48ICEVCHIND5_004851766..52152 [+], 387TraATraA_F, T4SS component 
49ICEVCHIND5_004952373..53164 [+], 792conserved hypothetical protein
50ICEVCHIND5_005053157..54095 [+], 939ync
51ICEVCHIND5_005154227..54919 [+], 693DsbCTrbB_I, T4SS component 
52traC54919..57318 [+], 2400type-IV secretion system protein TraCTraC_F, T4SS component 
53ICEVCHIND5_005357311..57658 [+], 348conserved hypothetical protein
54ICEVCHIND5_005457642..58154 [+], 513conjugation signal peptidaseTraF, T4SS component 
55ICEVCHIND5_005659273..60301 [+], 1029sex pilus assemblyTraU_F, T4SS component 
56ICEVCHIND5_005760304..63996 [+], 3693mating pair stabilizationTraN_F, T4SS component 
57ICEVCHIND5_005864087..65703 [-], 1617conserved hypothetical protein
58ICEVCHIND5_005965783..66538 [-], 756IstB domain protein ATP-binding proteinTrbB, T4SS component 
59ICEVCHIND5_006066528..68036 [-], 1509integrase, catalytic region
60ICEVCHIND5_006168135..69178 [-], 1044SMC domain protein
61ICEVCHIND5_006269382..70065 [-], 684endonuclease-1 (Endonuclease I) (Endo I)
62ICEVCHIND5_006370174..70776 [-], 603conserved hypothetical protein
63ICEVCHIND5_006471144..71470 [+], 327conserved hypothetical protein
64ICEVCHIND5_006571486..71905 [+], 420single-strand binding protein family
65ICEVCHIND5_006671985..72803 [+], 819phage recombination protein Bet
66ICEVCHIND5_006772885..73028 [+], 144hypothetical protein
67ICEVCHIND5_006873089..74105 [+], 1017YqaJ viral recombinase family
68ICEVCHIND5_007074198..75274 [+], 1077ATPase associated with various cellular activities, AAA_5
69ICEVCHIND5_006974294..74416 [-], 123hypothetical protein
70ICEVCHIND5_007175274..76041 [+], 768conserved hypothetical protein
71ICEVCHIND5_007276140..77093 [+], 954conserved hypothetical protein
72ICEVCHIND5_007377155..77595 [+], 441conserved hypothetical protein
73ICEVCHIND5_007477665..79320 [+], 1656von Willebrand factor, type A
74radC79405..79902 [+], 498DNA repair protein RadC
75ICEVCHIND5_007679902..80243 [+], 342conserved hypothetical protein
76ICEVCHIND5_007780334..81407 [+], 1074phage P4 alpha, zinc-binding domain protein
77ICEVCHIND5_007881497..82204 [+], 708conserved hypothetical protein
78ICEVCHIND5_007982397..82510 [-], 114hypothetical protein
79ICEVCHIND5_008182476..82880 [+], 405glyoxalase/bleomycin resistance protein/dioxygenase
80ICEVCHIND5_008082877..83578 [-], 702conserved hypothetical protein
81ICEVCHIND5_008283678..84040 [-], 363conserved hypothetical protein
82ICEVCHIND5_008384111..84521 [-], 411membrane associated protein containing xre-family DNA-binding HTH domain
83ICEVCHIND5_008484719..85144 [-], 426conserved hypothetical protein
84folA85249..85722 [-], 474dihydrofolate reductaseAR 
85ICEVCHIND5_008686940..87080 [-], 141hypothetical protein
86ICEVCHIND5_008887226..88170 [+], 945conserved hypothetical proteinTraF_F, T4SS component 
87ICEVCHIND5_008988173..89561 [+], 1389sex pilus assemblyTraH_F, T4SS component 
88ICEVCHIND5_009089565..93134 [+], 3570sex pilus assemblyTraG_F, T4SS component 
89ICEVCHIND5_009193167..93598 [-], 432EexR1
90ICEVCHIND5_009293656..94189 [-], 534transcriptional activator
91ICEVCHIND5_009394186..94485 [-], 300SetD
92ICEVCHIND5_009494482..95030 [-], 549lytic transglycosylase, catalyticOrf169_F, T4SS component 
93ICEVCHIND5_009595017..95679 [-], 663conserved hypothetical protein
94ICEVCHIND5_009695666..96535 [-], 870conserved hypothetical protein
95ICEVCHIND5_009796591..96842 [-], 252SetQ
96ICEVCHIND5_009896960..97607 [+], 648HTH-type transcriptional regulator for conjugative element R391
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins96Fasta
(1) Carraro N; Rivard N; Ceccarelli D; Colwell RR; Burrus V (2016). IncA/C Conjugative Plasmids Mobilize a New Family of Multidrug Resistance Islands in Clinical Vibrio cholerae Non-O1/Non-O139 Isolates from Haiti. MBio. 7(4). [PudMed:27435459]
(2) Sjolund-Karlsson M; Reimer A; Folster JP; Walker M; Dahourou GA; Batra DG; Martin I; Joyce K; Parsons MB; Boncy J; Whichard JM; Gilmour MW (2011). Drug-resistance mechanisms in Vibrio cholerae O1 outbreak strain, Haiti, 2010. Emerg Infect Dis. 17(11):2151-4. [PudMed:22099122]
(3) Spagnoletti M; Ceccarelli D; Colombo MM (2012). Rapid detection by multiplex PCR of Genomic Islands, prophages and Integrative Conjugative Elements in V. cholerae 7th pandemic variants. J Microbiol Methods. 88(1):98-102. [PudMed:22062086] experimental
(4) Ceccarelli D; Spagnoletti M; Bacciu D; Danin-Poleg Y; Mendiratta DK; Kashi Y; Cappuccinelli P; Burrus V; Colombo MM (2011). ICEVchInd5 is prevalent in epidemic Vibrio cholerae O1 El Tor strains isolated in India. Int J Med Microbiol. 301(4):318-24. [PudMed:21276749] experimental
(5) Wozniak RA; Fouts DE; Spagnoletti M; Colombo MM; Ceccarelli D; Garriss G; Dery C; Burrus V; Waldor MK (2009). Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PudMed:20041216] in_silico
(6) Bordeleau E; Brouillette E; Robichaud N; Burrus V (2010). Beyond antibiotic resistance: integrating conjugative elements of the SXT/R391 family that encode novel diguanylate cyclases participate to c-di-GMP signalling in Vibrio cholerae. Environ Microbiol. 12(2):510-23. [PudMed:19888998] experimental
 
experimental experimental literature
in_silico in silico analysis literature