ICEberg
I. Information of ICE
ICEberg ID21
Name ICEVchInd4 This ICE is derived from experimental literature
FamilySXT/R391
OrganismVibrio cholerae O139 Ind4
Size (bp)95326
GC content [Genome] (%)46.87
Insertion siteprfC
FunctionAntibiotic resistance genes: floR, strBA, sul2; Toxin-antitoxin system
Species that ICE can be transferred to-
Nucleotide SequenceGQ463141 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..95326 
Putative oriT region coordinates: 3489..3595;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 40986..43136; Locus tag: ICEVCHIND4_0034;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEVchInd4 is not available.



The graph information of ICEVchInd4 components from GQ463141
Complete gene list of ICEVchInd4 from GQ463141
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1ICEVCHIND4_0001419..613 [+], 195conserved domain protein
2ICEVCHIND4_0002630..1871 [-], 1242integraseIntegrase 
3ICEVCHIND4_00031873..2142 [-], 270conserved hypothetical protein
4ICEVCHIND4_00042145..3119 [-], 975conserved hypothetical protein
5ICEVCHIND4_00053215..3382 [+], 168hypothetical protein
6ICEVCHIND4_00063584..4027 [+], 444conserved hypothetical protein
7ICEVCHIND4_00074038..5210 [-], 1173protein UmuC
8ICEVCHIND4_00085494..6087 [+], 594transposase, IS3 family, interruption
9ICEVCHIND4_00096201..9179 [+], 2979transposase
10ICEVCHIND4_00109597..11090 [+], 1494iscr2 transposase
11ICEVCHIND4_001111121..12005 [+], 885conserved hypothetical protein
12ICEVCHIND4_001212222..13436 [+], 1215florfenicol/chloramphenicol resistance proteinAR 
13ICEVCHIND4_001313464..13769 [+], 306truncated helix-turn-helix multiple antibiotic resistance protein
14ICEVCHIND4_001513890..14420 [+], 531truncated transposase
15ICEVCHIND4_001414392..15222 [-], 831streptomycin resistance protein BAR 
16ICEVCHIND4_001615228..16031 [-], 804streptomycin 3''-kinaseAR 
17folP16092..16907 [-], 816dihydropteroate synthaseAR 
18ICEVCHIND4_001817378..18991 [+], 1614TnpA
19ICEVCHIND4_001919334..19603 [-], 270ultraviolet light resistance protein B
20ICEVCHIND4_002019611..20060 [-], 450protein UmuD
21ICEVCHIND4_002120179..20316 [+], 138hypothetical protein
22ICEVCHIND4_002220699..21607 [+], 909exonuclease, RNase T and DNA polymerase III
23ICEVCHIND4_002321681..21995 [+], 315conserved hypothetical protein
24ICEVCHIND4_002422103..22990 [+], 888conserved hypothetical protein
25ICEVCHIND4_002523000..23599 [+], 600conserved hypothetical protein
26ICEVCHIND4_002623596..24180 [+], 585conserved hypothetical protein
27ICEVCHIND4_002724199..27876 [+], 3678conserved hypothetical protein
28ICEVCHIND4_002827887..29056 [+], 1170conserved hypothetical protein
29ICEVCHIND4_002929053..29811 [+], 759conserved hypothetical protein
30ICEVCHIND4_003029815..33387 [+], 3573type II restriction enzyme
31ICEVCHIND4_003133387..36044 [+], 2658conserved hypothetical protein
32ICEVCHIND4_003236061..38136 [+], 2076conserved hypothetical protein
33ICEVCHIND4_003338180..40831 [+], 2652DNA repair ATPase
34ICEVCHIND4_003440986..43136 [+], 2151conjugative relaxaseRelaxase, MOBH Family
35ICEVCHIND4_003543185..45005 [+], 1821conjugative coupling factorTraD_F, T4SS component 
36ICEVCHIND4_003645015..45575 [+], 561conserved hypothetical protein
37ICEVCHIND4_003745562..46197 [+], 636putative conjugation coupling factor
38ICEVCHIND4_003846223..46501 [-], 279transcriptional regulator, XRE family
39ICEVCHIND4_003946498..46821 [-], 324conserved hypothetical protein
40traL47002..47283 [+], 282type IV conjugative transfer system protein TraLTraL_F, T4SS component 
41ICEVCHIND4_004147280..47906 [+], 627sex pilus assemblyTraE_F, T4SS component 
42ICEVCHIND4_004247890..48786 [+], 897TraKTraK_F, T4SS component 
43ICEVCHIND4_004348789..50078 [+], 1290sex pilus assemblyTraB_F, T4SS component 
44ICEVCHIND4_004450075..50725 [+], 651sex pilus assemblyTraV_F, T4SS component 
45ICEVCHIND4_004550722..51108 [+], 387TraATraA_F, T4SS component 
46ICEVCHIND4_004651179..52120 [+], 942conserved hypothetical protein
47ICEVCHIND4_004752113..53051 [+], 939ync
48ICEVCHIND4_004853183..53875 [+], 693DsbCTrbB_I, T4SS component 
49traC53875..56274 [+], 2400type-IV secretion system protein TraCTraC_F, T4SS component 
50ICEVCHIND4_005056267..56614 [+], 348conserved hypothetical protein
51ICEVCHIND4_005156598..57110 [+], 513conjugation signal peptidaseTraF, T4SS component 
52ICEVCHIND4_005257121..58245 [+], 1125sex pilus assemblyTraW_F, T4SS component 
53ICEVCHIND4_005358277..59257 [+], 981sex pilus assemblyTraU_F, T4SS component 
54ICEVCHIND4_005459260..62958 [+], 3699mating pair stabilizationTraN_F, T4SS component 
55ICEVCHIND4_005563051..63731 [-], 681hypothetical protein
56ICEVCHIND4_005663738..64823 [-], 1086conserved hypothetical protein
57ICEVCHIND4_005764823..65887 [-], 1065conserved hypothetical protein
58ICEVCHIND4_005866000..66683 [-], 684endonuclease-1 (Endonuclease I) (Endo I)
59ICEVCHIND4_005966816..67418 [-], 603conserved hypothetical protein
60ICEVCHIND4_006067655..67786 [-], 132hypothetical protein
61ICEVCHIND4_006167786..68112 [+], 327conserved hypothetical protein
62ICEVCHIND4_006268128..68547 [+], 420single-strand binding protein family
63ICEVCHIND4_006368627..69445 [+], 819phage recombination protein Bet
64ICEVCHIND4_006469527..69670 [+], 144hypothetical protein
65ICEVCHIND4_006569731..70747 [+], 1017YqaJ viral recombinase family
66ICEVCHIND4_006670957..71916 [+], 960ATPase associated with various cellular activities, AAA_5
67ICEVCHIND4_006771919..72683 [+], 765conserved hypothetical protein
68ICEVCHIND4_006872782..73735 [+], 954conserved hypothetical protein
69ICEVCHIND4_006973797..74237 [+], 441conserved hypothetical protein
70ICEVCHIND4_007074307..75962 [+], 1656von Willebrand factor, type A
71radC76044..76541 [+], 498DNA repair protein RadC
72ICEVCHIND4_007276541..76882 [+], 342conserved hypothetical protein
73ICEVCHIND4_007376974..78047 [+], 1074phage P4 alpha, zinc-binding domain protein
74ICEVCHIND4_007478138..78845 [+], 708conserved hypothetical protein
75ICEVCHIND4_007579108..80037 [-], 930response regulator receiver protein
76ICEVCHIND4_007680043..83849 [-], 3807multi-sensor hybrid histidine kinase
77ICEVCHIND4_007783840..83956 [+], 117hypothetical protein
78ICEVCHIND4_007884584..85528 [+], 945conserved hypothetical proteinTraF_F, T4SS component 
79ICEVCHIND4_007985531..86919 [+], 1389sex pilus assemblyTraH_F, T4SS component 
80ICEVCHIND4_008086923..90492 [+], 3570sex pilus assemblyTraG_F, T4SS component 
81ICEVCHIND4_008190525..90956 [-], 432EexS
82ICEVCHIND4_008291011..91544 [-], 534transcriptional activator
83ICEVCHIND4_008391541..91840 [-], 300SetD
84ICEVCHIND4_008491837..92385 [-], 549lytic transglycosylase, catalyticOrf169_F, T4SS component 
85ICEVCHIND4_008592372..93034 [-], 663conserved hypothetical protein
86ICEVCHIND4_008693021..93890 [-], 870conserved hypothetical protein
87ICEVCHIND4_008793946..94197 [-], 252SetQ
88ICEVCHIND4_008894315..94962 [+], 648HTH-type transcriptional regulator for conjugative element R391
89ICEVCHIND4_008995219..95326 [+], 108peptide termination factor
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins89Fasta
(1) Wozniak RA; Fouts DE; Spagnoletti M; Colombo MM; Ceccarelli D; Garriss G; Dery C; Burrus V; Waldor MK (2009). Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PudMed:20041216] in_silico
(2) Marrero J; Waldor MK (2007). The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 189(8):3302-5. [PudMed:17307849] experimental
 
experimental experimental literature
in_silico in silico analysis literature