ICEberg
I. Information of ICE
ICEberg ID180
Name ICEKpnHS11286-1 This is a putative ICE identified in this study by Blast
FamilyICEKp1
OrganismKlebsiella pneumoniae HS11286
Size (bp)62230
GC content [Genome] (%)52.45[57.48]
Insertion sitetRNA-Asn34 (KPHS_34600)
Function-
Species that ICE can be transferred to-
Nucleotide SequenceCP003200 (complete ICE sequence in this genome)
Replicon chromosome (5333942 bp, BioProject:78789) [CP003200]
Genome coordinates3433546..3495775 
Putative oriT region coordinates: 3479689..3479812;   oriTDB id:  200012
CCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGC
TAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCC
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of ICEKpnHS11286-1 is not available.



The graph information of ICEKpnHS11286-1 components from CP003200
Complete gene list of ICEKpnHS11286-1 from CP003200
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1KPHS_345603428850..3429770 [+], 921LysR family transcriptional regulator
2KPHS_345703430155..3431096 [-], 942hypothetical protein
3KPHS_345803431175..3432125 [-], 951transcriptional regulator Cbl
4KPHS_345903432232..3433149 [-], 918nitrogen assimilation transcriptional regulator
5KPHS_346003433717..3434979 [+], 1263integraseIntegrase 
6KPHS_346103435173..3436477 [-], 1305salicylate synthase Irp9
7KPHS_346203436505..3437785 [-], 1281MFS superfamily transporter signal transducer
8KPHS_346303437778..3439580 [-], 1803permease and ATP-binding protein of yersiniabactin-iron ABC transporter YbtQ
9KPHS_346403439567..3441279 [-], 1713lipoprotein inner membrane ABC-transporter
10KPHS_346503441536..3442495 [+], 960AraC-type transcriptional regulator
11KPHS_346603442686..3448793 [+], 6108High-molecular-weight nonribosomal peptide/polyketide synthetase 2 (HMWP2)
12KPHS_346703448881..3458372 [+], 9492High-molecular-weight nonribosomal peptide/polyketide synthetase 1 (HMWP1)
13KPHS_346803458369..3459469 [+], 1101irp3 protein, yersiniabactin siderophore biosynthetic protein
14KPHS_346903459532..3460269 [+], 738putative thioesterase YbtT
15KPHS_347003460273..3461850 [+], 1578yersiniabactin siderophore biosynthetic protein
16KPHS_347103461981..3464002 [+], 2022pesticin/yersiniabactin TonB-dependent receptor
17KPHS_347203464874..3465800 [+], 927hypothetical protein
18KPHS_347303466314..3466895 [+], 582hypothetical protein
19KPHS_347403467337..3467465 [+], 129hypothetical protein
20KPHS_347503468034..3468267 [+], 234hypothetical protein
21KPHS_347603468340..3469050 [+], 711putative type IV secretory pathway VirB1 componentVirB1, T4SS component 
22KPHS_347703469164..3469343 [+], 180hypothetical proteinVirB2, T4SS component 
23KPHS_347803469356..3472094 [+], 2739putative type IV secretory pathway VirB4 componentVirB4, T4SS component 
24KPHS_347903472112..3472819 [+], 708hypothetical proteinVirB5, T4SS component 
25KPHS_348003473073..3474146 [+], 1074hypothetical proteinVirB6, T4SS component 
26KPHS_348103474219..3474338 [-], 120hypothetical protein
27KPHS_348203474368..3475051 [+], 684type IV secretion system VirB8 componentVirB8, T4SS component 
28KPHS_348303475048..3475956 [+], 909type IV secretory pathway VirB9 componentVirB9, T4SS component 
29KPHS_348403476000..3477250 [+], 1251type IV secretory pathway VirB10 componentVirB10, T4SS component 
30KPHS_348503477240..3478265 [+], 1026type IV secretory pathway VirB11 componentVirB11, T4SS component 
31KPHS_348603479193..3479348 [+], 156hypothetical protein
32KPHS_348703480058..3481917 [+], 1860putative MobB mobilization proteinVirD4, T4SS component 
33KPHS_348803481927..3482673 [+], 747putative MobC mobilization protein
34KPHS_348903482866..3483810 [-], 945putative Antirestriction protein ardC
35KPHS_349003484816..3485811 [+], 996hypothetical protein
36KPHS_349103485808..3486896 [+], 1089hypothetical protein
37KPHS_349203487133..3487387 [+], 255hypothetical protein
38KPHS_349303487384..3489264 [+], 1881hypothetical protein
39KPHS_349403489548..3490567 [-], 1020hypothetical protein
40KPHS_349503491966..3494212 [+], 2247hypothetical protein
41KPHS_349603494327..3495427 [+], 1101putative Retron-type reverse transcriptase
42KPHS_349703495637..3495780 [-], 144hypothetical protein
43KPHS_349803495799..3497433 [-], 1635putative sodium:hydrogen antiporter
44KPHS_349903498025..3498849 [+], 825putative regulatory protein TetR
45KPHS_350003498899..3499702 [+], 804putative dehydrogenase
46KPHS_350103499777..3499920 [-], 144hypothetical protein
 
flank Flanking regions
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins37Fasta
Identified as part of this study from CP003200