ICEberg
I. Information of ICE
ICEberg ID15
Name ICEVchBan8 This is a predicted ICE derived from literature
FamilySXT/R391
OrganismVibrio cholerae MZO-3
Size (bp)103382
GC content [Genome] (%)41.8
Insertion sitetRNA-Ser
FunctionToxin-antitoxin system
Species that ICE can be transferred to-
Nucleotide SequenceJQ345361 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..103382 
Putative oriT region coordinates: 6385..6491;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of ICEVchBan8 is not available.



The graph information of ICEVchBan8 components from JQ345361
Complete gene list of ICEVchBan8 from JQ345361
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-178..825 [-], 648putative cI prophage repressor protein
2-943..1194 [+], 252hypothetical protein
3-1250..2119 [+], 870hypothetical protein
4-2106..2768 [+], 663hypothetical protein
5-2755..3303 [+], 549hypothetical protein
6-3300..3599 [+], 300hypothetical protein
7-3596..4129 [+], 534hypothetical protein
8-4184..4615 [+], 432hypothetical protein
9-4769..5038 [-], 270hypothetical protein
10-5041..6015 [-], 975rod shape determination protein
11-6111..6233 [+], 123hypothetical protein
12-6480..6923 [+], 444hypothetical protein
13-7061..7180 [-], 120error-prone, lesion bypass DNA polymerase V
14-7180..7479 [-], 300error-prone, lesion bypass DNA polymerase V
15-7448..7897 [-], 450error-prone repair protein
16-7896..8153 [+], 258hypothetical protein
17-8935..9408 [-], 474transposase
18-9756..11906 [+], 2151conjugative transfer protein TraI
19-11955..13775 [+], 1821IncF plasmid conjugative transfer protein TraD
20-13785..14345 [+], 561conjugative transfer protein 234
21-14332..14967 [+], 636conjugative transfer protein s043
22-14993..15271 [-], 279hypothetical protein
23-15268..15591 [-], 324hypothetical protein
24-15605..15736 [-], 132hypothetical protein
25-15841..16053 [+], 213IncF plasmid conjugative transfer pilus assembly protein TraL
26-16050..16676 [+], 627IncF plasmid conjugative transfer pilus assembly protein TraE
27-16660..17556 [+], 897IncF plasmid conjugative transfer pilus assembly protein TraK
28-17559..18848 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraB
29-18923..19495 [+], 573conjugative transfer protein TraV
30-19492..19878 [+], 387conjugative transfer protein TraA
31-20056..20889 [+], 834Ynd
32-20882..21820 [+], 939Ync
33-22004..22147 [+], 144hypothetical protein
34-22343..22999 [-], 657hypothetical protein
35-23043..23189 [-], 147hypothetical protein
36-23431..24123 [+], 693thiol:disulfide
37-24123..26522 [+], 2400IncF plasmid conjugative transfer pilus assembly protein TraC
38-26515..26862 [+], 348conjugative transfer protein 345
39-26846..27358 [+], 513conjugative signal peptidase
40-27369..28493 [+], 1125IncF plasmid conjugative transfer pilus assembly protein TraW
41-28525..29505 [+], 981IncF plasmid conjugative transfer pilus assembly protein TraU
42-29508..33206 [+], 3699IncF plasmid conjugative transfer protein TraN
43-33384..34559 [+], 1176FOG: TPR repeat protein
44-34573..35418 [+], 846outer membrane lipoprotein A precursor
45-35745..35894 [+], 150hypothetical protein
46-36729..36896 [+], 168ABC transporter, periplasmic substrate-binding protein
47-36928..37185 [+], 258hypothetical protein
48-37230..37883 [+], 654transposase and inactivated derivative
49-38673..43061 [+], 4389Accessory colonization factor AcfD precursor
50-43128..43682 [+], 555hypothetical protein
51-43778..44698 [-], 921transposase
52-45230..45859 [-], 630Accessory colonization factor AcfA
53-46732..46902 [+], 171hypothetical protein
54-47188..47571 [+], 384transthyretin family protein
55-47621..47743 [-], 123hypothetical protein
56-47716..48099 [+], 384protein of unknown function DUF336
57-48409..50502 [+], 2094Surface protein Lk90-like protein
58-50844..51629 [-], 786Beta-ketoadipate enol-lactone hydrolase
59-51992..52144 [+], 153hypothetical protein
60-52601..53332 [+], 732toxin co-regulated pilin A
61-53384..54922 [+], 1539toxin co-regulated pilus biosynthesis protein B
62-54941..55312 [+], 372toxin co-regulated pilus biosynthesis protein Q
63-55319..56779 [+], 1461toxin co-regulated pilus biosynthesis protein C, outer membrane protein
64-56781..57320 [+], 540hypothetical protein
65-57317..58150 [+], 834toxin co-regulated pilus biosynthesis protein D
66-58138..58671 [+], 534CofG
67-58673..60205 [+], 1533toxin co-regulated pilus biosynthesis protein T, putative ATP-binding translocase of TcpA
68-60246..61217 [+], 972toxin co-regulated pilus biosynthesis protein E, anchors TcpT to membrane
69-61218..61982 [+], 765TCP pilin signal peptidase, TcpA processing
70-62057..62734 [+], 678toxin co-regulated pilus biosynthesis protein P, transcriptional activator of ToxT promoter
71-62946..63110 [+], 165hypothetical protein
72-63198..63995 [+], 798TCP pilus virulence regulatory protein ToxT, transcription activator
73-64000..64719 [+], 720hypothetical protein
74-64748..65497 [+], 750Accessory colonization factor AcfC
75-65598..66617 [+], 1020hypothetical protein
76-66748..69669 [-], 2922Lipoprotein, ToxR-activated gene, TagA
77-69736..70140 [-], 405methyl-accepting chemotaxis sensory transducer
78-70328..70555 [-], 228hypothetical protein
79-70973..71776 [+], 804transcriptional regulator, AraC family
80-72305..73066 [-], 762putative regulatory protein
81-73239..76304 [-], 3066AcrB/AcrD/AcrF family protein
82-76310..77395 [-], 1086hypothetical protein
83-78009..78146 [+], 138hypothetical protein
84-78225..80030 [-], 1806CtxA
85-80450..80824 [+], 375transposase
86-80931..81284 [+], 354transposase
87-81235..81357 [+], 123transposase
88-81767..82393 [-], 627Probable signal peptide protein
89-82760..83365 [-], 606hypothetical protein
90-83602..83718 [-], 117hypothetical protein
91-83775..84059 [+], 285hypothetical protein
92-84075..84494 [+], 420Single-stranded DNA-binding protein
93-84574..85392 [+], 819Recombination protein BET
94-85474..85617 [+], 144hypothetical protein
95-85678..86694 [+], 1017hypothetical protein
96-86904..87182 [+], 279Aerobic cobaltochelatase CobS subunit
97-87249..87863 [+], 615Aerobic cobaltochelatase CobS subunit
98-87863..88630 [+], 768hypothetical protein
99-88729..89682 [+], 954Cobalamine biosynthesis protein
100-89744..90184 [+], 441hypothetical protein
101-90254..91903 [+], 1650Plasmid associated gene product APECO1_O1R37
102-91986..92483 [+], 498DNA repair protein RadC
103-92483..92824 [+], 342hypothetical protein
104-92915..93982 [+], 1068Phage P4 alpha, zinc-binding domain protein
105-94072..94776 [+], 705hypothetical protein
106-94881..95819 [+], 939IncF plasmid conjugative transfer pilus assembly protein TraF
107-95816..97204 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraH
108-97208..100777 [+], 3570IncF plasmid conjugative transfer protein TraG
109-100950..101261 [-], 312hypothetical protein
110-101460..101648 [-], 189transcriptional regulator
111-101731..102963 [-], 1233Phage integrase
 

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins111Fasta
(1) Taviani E; Spagnoletti M; Ceccarelli D; Haley BJ; Hasan NA; Chen A; Colombo MM; Huq A; Colwell RR (2012). Genomic analysis of ICEVchBan8: An atypical genetic element in Vibrio cholerae. FEBS Lett. 586(11):1617-21. [PudMed:22673571] in_silico
(2) Wozniak RA; Fouts DE; Spagnoletti M; Colombo MM; Ceccarelli D; Garriss G; Dery C; Burrus V; Waldor MK (2009). Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PudMed:20041216] in_silico
 
in_silico in silico analysis literature