ICEberg
I. Information of ICE
ICEberg ID130
Name ICECkoBAA-1 This is a putative ICE identified in this study by Blast
FamilyICEKp1
OrganismCitrobacter koseri ATCC BAA-895
Size (bp)103383
GC content [Genome] (%)53.68[53.83]
Insertion siteccagtcagaggag(conserved seq. of the tRNA-asn 3'-end)
FunctionSalicylate synthesis
Species that ICE can be transferred to-
Nucleotide SequenceCP000822 (complete ICE sequence in this genome)
Replicon chromosome (4720462 bp, BioProject:12716) [NC_009792]
Genome coordinates816173..919555 
Putative oriT region coordinates: 872969..873092;   oriTDB id:  200012
GGCGGCACACCGTCGCGCGCTACGCGCGACCAACCCCTTTAAGACGCGCGTTTAGCCTATTTTTTCTTCG
CAAGCTCGAAAAAATGGGAACGCTGCTTTAAAGGGGTTGGTCGCGCCTAATCGG
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of ICECkoBAA-1 is not available.



The graph information of ICECkoBAA-1 components from CP000822
Complete gene list of ICECkoBAA-1 from CP000822
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1CKO_00849811698..813014 [-], 1317hypothetical protein
2CKO_00850813243..814076 [+], 834hypothetical protein
3CKO_00851814069..815052 [+], 984hypothetical protein
4CKO_00852815049..816059 [+], 1011hypothetical protein
5CKO_00853816421..816819 [+], 399hypothetical protein
6CKO_00855817127..817606 [-], 480hypothetical protein
7CKO_00854817382..817714 [+], 333hypothetical protein
8CKO_00856817711..817977 [-], 267hypothetical protein
9CKO_00857818123..818857 [-], 735hypothetical protein
10CKO_00858818858..819082 [-], 225hypothetical protein
11CKO_00859819506..829132 [+], 9627hypothetical protein
12CKO_00861829028..829201 [-], 174hypothetical protein
13CKO_00860829164..831773 [+], 2610hypothetical protein
14CKO_00862831783..832652 [+], 870hypothetical protein
15CKO_00863832676..832930 [+], 255hypothetical protein
16CKO_00865832793..832993 [-], 201hypothetical protein
17CKO_00864832934..834064 [+], 1131hypothetical protein
18CKO_00866834061..835329 [+], 1269hypothetical protein
19CKO_00867835377..840173 [+], 4797hypothetical protein
20CKO_00868840223..843255 [+], 3033hypothetical protein
21CKO_00869843299..849799 [+], 6501hypothetical protein
22CKO_00870849741..856274 [+], 6534hypothetical protein
23CKO_00871856267..857730 [+], 1464hypothetical protein
24CKO_00872857792..859231 [+], 1440hypothetical protein
25CKO_00873859228..863595 [+], 4368hypothetical protein
26CKO_00874863626..866085 [+], 2460hypothetical protein
27CKO_00875866152..867612 [+], 1461hypothetical protein
28CKO_00876867758..868327 [+], 570hypothetical protein
29CKO_00877868362..868874 [+], 513hypothetical protein
30CKO_00878869101..869256 [+], 156hypothetical protein
31CKO_00879870144..870908 [-], 765hypothetical protein
32CKO_00880870917..872671 [-], 1755hypothetical proteinVirD4, T4SS component 
33CKO_00881872747..873001 [-], 255hypothetical protein
34CKO_00882873294..873581 [+], 288hypothetical protein
35CKO_00883873434..873739 [-], 306hypothetical protein
36CKO_00884873782..874150 [-], 369hypothetical proteinMagB14, T4SS component 
37CKO_00885874117..874515 [-], 399hypothetical protein
38CKO_00886874512..875537 [-], 1026hypothetical proteinVirB11, T4SS component 
39CKO_00888875527..875847 [-], 321hypothetical protein
40CKO_00887875696..875869 [+], 174hypothetical protein
41CKO_00889875859..877103 [-], 1245hypothetical proteinVirB10, T4SS component 
42CKO_00890877147..878055 [-], 909hypothetical proteinVirB9, T4SS component 
43CKO_00891878052..878735 [-], 684hypothetical proteinVirB8, T4SS component 
44CKO_00892878728..878880 [-], 153hypothetical proteinVirB7, T4SS component 
45CKO_00893878957..880030 [-], 1074hypothetical proteinVirB6, T4SS component 
46CKO_00894880034..880276 [-], 243hypothetical proteinMagB05, T4SS component 
47CKO_00895880284..880991 [-], 708hypothetical proteinVirB5, T4SS component 
48CKO_00896881009..883747 [-], 2739hypothetical proteinVirB4, T4SS component 
49CKO_00897883760..884053 [-], 294hypothetical proteinVirB2, T4SS component 
50CKO_00898884053..884763 [-], 711hypothetical proteinVirB1, T4SS component 
51CKO_00899884836..885069 [-], 234hypothetical protein
52CKO_00900885330..885470 [+], 141hypothetical protein
53CKO_00901885638..885766 [-], 129hypothetical protein
54CKO_00902886208..886789 [-], 582hypothetical protein
55CKO_00903886978..887163 [-], 186hypothetical protein
56CKO_00904887303..888229 [-], 927hypothetical protein
57CKO_00905889101..891122 [-], 2022hypothetical protein
58CKO_00906891253..892830 [-], 1578hypothetical protein
59CKO_00907892834..893622 [-], 789hypothetical protein
60CKO_00908893634..894734 [-], 1101hypothetical protein
61CKO_00909894731..904222 [-], 9492hypothetical protein
62CKO_00910904310..904987 [-], 678hypothetical protein
63CKO_00911904911..910421 [-], 5511hypothetical protein
64CKO_00912910612..911571 [-], 960hypothetical protein
65CKO_00913911828..913540 [+], 1713hypothetical protein
66CKO_00914913527..915329 [+], 1803hypothetical protein
67CKO_00915915322..916602 [+], 1281hypothetical protein
68CKO_00916916630..917934 [+], 1305hypothetical protein
69CKO_00917918128..919390 [-], 1263hypothetical proteinIntegrase 
70CKO_00918919780..919872 [-], 93hypothetical protein
71CKO_00920919791..920003 [-], 213hypothetical protein
72CKO_00919919903..920859 [+], 957hypothetical protein
73CKO_00921920970..921878 [+], 909hypothetical protein
74CKO_00922922084..922587 [-], 504hypothetical protein
75CKO_00923922699..922938 [+], 240hypothetical protein
76CKO_00924923020..923118 [+], 99hypothetical protein
77CKO_00925923155..924378 [+], 1224hypothetical protein
 
flank Flanking regions
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins65Fasta
Identified as part of this study from CP000822