ICEberg
I. Information of ICE
ICEberg ID129
Name ICEEcoED1a-1 This is a putative ICE identified in this study by Blast
FamilyICEKp1
OrganismEscherichia coli ED1a
Size (bp)58182
GC content [Genome] (%)53.13[50.73]
Insertion sitetRNA-asn(ECED1_tRNA22)
FunctionYersiniabactin synthesis
Species that ICE can be transferred to-
Nucleotide SequenceCU928162 (complete ICE sequence in this genome)
Replicon chromosome (5209548 bp, BioProject:33409) [NC_011745]
Genome coordinates2164157..2222338 
Putative oriT region coordinates: 2210273..2210396;   oriTDB id:  200012
CCGATTAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCATTTTTTCGAGCTTGCGAAGAAAAAATAGGC
TAAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGTGCGACGGTGTGCCGCC
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of ICEEcoED1a-1 is not available.



The graph information of ICEEcoED1a-1 components from CU928162
Complete gene list of ICEEcoED1a-1 from CU928162
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1yedZ2160015..2160650 [+], 636heme-molybdoenzyme heme-containing subunit YedZ; cytochrome b subunit
2yodA2160907..2161557 [+], 651conserved hypothetical protein; putative metal-binding protein
3ECED1_22392161667..2161816 [+], 150conserved hypothetical protein
4yodB2161900..2162430 [+], 531putative cytochrome
5yeeI2163183..2163980 [+], 798conserved hypothetical protein
6int2164318..2165580 [+], 1263integraseIntegrase 
7irp2165774..2167078 [-], 1305Salicylate synthase
8irp2167106..2168509 [-], 1404putative permease of yersiniabactin-iron transporter YbtX
9irp2168379..2170208 [-], 1830permease and ATP-binding protein of yersiniabactin-iron ABC transporter YbtQ
10irp2170168..2171970 [-], 1803permease and ATP-binding protein of yersiniabactin-iron ABC transporter YbtP
11ybtA2172137..2173096 [+], 960AraC type regulator of yersiniabactin gene cluster (HPI)
12irp2173269..2179394 [+], 6126High-molecular-weight nonribosomal peptide/polyketide synthetase 2 (HMWP2)
13irp2179482..2188973 [+], 9492High-molecular-weight nonribosomal peptide/polyketide synthetase 1 (HMWP1)
14irp2188910..2190070 [+], 1161Thiazolinyl-S-HMWP1 reductase YbtU
15irp2190067..2190870 [+], 804putative thioesterase YbtT
16irp2190874..2192451 [+], 1578salicyl-AMP ligase YbtE
17fyuA2192582..2194603 [+], 2022Yersiniabactin/pesticin outer membrane receptor (IRPC)
18ECED1_22552195417..2196400 [+], 984conserved hypothetical protein
19ECED1_22562196744..2196929 [+], 186conserved hypothetical protein
20ECED1_22572196914..2197495 [+], 582conserved hypothetical protein
21ECED1_22582197485..2197694 [+], 210putative lambdoid prophage protein from the DksA/TraR family with a zinc finger
22ECED1_22592197937..2198065 [+], 129conserved hypothetical protein
23ECED1_22602198634..2198867 [+], 234conserved hypothetical protein
24ECED1_22612198922..2199650 [+], 729putative type IV secretory pathway VirB1 componentVirB1, T4SS component 
25ECED1_22622199650..2199943 [+], 294putative type IV secretory pathway VirB2 componentVirB2, T4SS component 
26ECED1_22632199956..2202694 [+], 2739putative type IV secretory pathway VirB4 componentVirB4, T4SS component 
27ECED1_22642202712..2203419 [+], 708putative type IV secretory pathway VirB5 componentVirB5, T4SS component 
28ECED1_22652203427..2203669 [+], 243conserved hypothetical protein; putative exported proteinMagB05, T4SS component 
29ECED1_22662203673..2204746 [+], 1074putative type IV secretory pathway VirB6 componentVirB6, T4SS component 
30ECED1_22672204968..2205651 [+], 684putative type IV secretory pathway VirB8 componentVirB8, T4SS component 
31ECED1_22682205648..2206556 [+], 909putative type IV secretory pathway VirB9 componentVirB9, T4SS component 
32ECED1_22692206586..2207842 [+], 1257putative type IV secretory pathway VirB10 componentVirB10, T4SS component 
33ECED1_22702207832..2208857 [+], 1026putative type IV secretory pathway VirB11 componentVirB11, T4SS component 
34ECED1_22712208854..2209252 [+], 399conserved hypothetical protein; putative exported protein
35kikA2209288..2209593 [+], 306putative plasmid conjugation protein
36ECED1_22732209627..2209932 [+], 306conserved hypothetical protein
37ECED1_22742210612..2212501 [+], 1890putative MobB mobilization proteinVirD4, T4SS component 
38ECED1_22752212511..2213257 [+], 747putative MobC mobilization protein
39ECED1_22762213451..2214497 [-], 1047putative Antirestriction protein ardC
40ECED1_22772215060..2215323 [-], 264Transposase, ORF A, IS3 family, IS407 group
41ECED1_22782215465..2216523 [-], 1059conserved hypothetical protein
42ECED1_22792216529..2218313 [-], 1785conserved hypothetical protein
43ECED1_22802218310..2219875 [-], 1566putative Restriction modification system, type I similar to hsdS (fragment)
44ECED1_22812219872..2221545 [-], 1674putative HsdM; type I restriction modification enzyme methylase subunit
 
flank Flanking regions
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins39Fasta
Identified as part of this study from CU928162