ICEberg
I. Information of ICE
ICEberg ID128
Name ICEDdaEch586-1 This is a putative ICE identified in this study by Blast
FamilyICEKp1
OrganismDickeya dadantii Ech586
Size (bp)51067
GC content [Genome] (%)48.09[53.64]
Insertion sitetRNA-asn(Dd586_R0052)
Function-
Species that ICE can be transferred to-
Nucleotide SequenceCP001836 (complete ICE sequence in this genome)
Replicon chromosome (4818394 bp, BioProject:42519) [NC_013592]
Genome coordinates2972027..3023093 
Putative oriT region coordinates: 3010188..3010310;   oriTDB id:  200013
CCGATCAGGCGCGACCAACCCCTTTAAAGCAGCGTTCCCGTTTTTTGGAGCTTGCGAGAAAAAACAGGCG
AAACGCGCGTCTTAAAGGGGTTGGTCGCGCGTAGCGGGCGACGGTGTGCCGCC
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of ICEDdaEch586-1 is not available.



The graph information of ICEDdaEch586-1 components from CP001836
Complete gene list of ICEDdaEch586-1 from CP001836
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1Dd586_26332967367..2968440 [+], 1074transcriptional regulator, LacI family
2Dd586_26342968629..2971739 [+], 3111glycoside hydrolase family 2 TIM barrel
3Dd586_26352972189..2973460 [+], 1272integrase family proteinIntegrase 
4Dd586_26372973922..2974164 [-], 243twin-arginine translocation protein, TatA/E family subunit
5Dd586_26382974312..2975388 [-], 1077conserved hypothetical protein
6Dd586_26392975451..2975828 [-], 378protein of unknown function DUF1330
7Dd586_26402976019..2976912 [-], 894transcriptional regulator, LysR family
8Dd586_26412977397..2978092 [+], 696two component transcriptional regulator, winged helix family
9Dd586_26422978101..2979489 [+], 1389multi-sensor signal transduction histidine kinase
10Dd586_26432979581..2979835 [-], 255protein of unknown function DUF1471
11Dd586_26442980141..2981265 [+], 1125dienelactone hydrolase
12Dd586_26452981371..2982030 [+], 660flavodoxin
13Dd586_26462982051..2982737 [+], 687conserved hypothetical protein
14Dd586_26472982878..2983621 [-], 744NAD(P)H dehydrogenase (quinone)
15Dd586_26482983646..2984407 [-], 762short-chain dehydrogenase/reductase SDR
16Dd586_26492984611..2985753 [-], 1143NADH:flavin oxidoreductase/NADH oxidase
17Dd586_26502986038..2986676 [-], 639flavodoxin/nitric oxide synthase
18Dd586_26512986814..2987827 [-], 1014Alcohol dehydrogenase zinc-binding domain protein
19Dd586_26522988178..2989173 [+], 996aldo/keto reductase
20Dd586_26532989300..2989977 [-], 678NAD(P)H dehydrogenase (quinone)
21Dd586_26542990289..2990882 [-], 594NAD(P)H dehydrogenase (quinone)
22Dd586_26552991101..2992003 [+], 903transcriptional regulator, AraC family
23Dd586_26572992682..2993596 [+], 915conserved hypothetical protein
24Dd586_26582993749..2993943 [+], 195phage transcriptional regulator, AlpA
25Dd586_26592993958..2994542 [+], 585conserved hypothetical protein
26Dd586_26602994532..2994735 [+], 204transcriptional regulator, TraR/DksA family
27Dd586_26612994911..2995762 [-], 852transcriptional regulator, LysR family
28Dd586_26622995862..2996725 [+], 864protein of unknown function DUF6 transmembrane
29Dd586_26632997209..2997442 [+], 234conserved hypothetical protein
30Dd586_26642997519..2998226 [+], 708Lytic transglycosylase catalyticVirB1, T4SS component 
31Dd586_26652998226..2998519 [+], 294Conjugal transfer protein TrbCVirB2, T4SS component 
32Dd586_26662998530..3001274 [+], 2745CagE, TrbE, VirB component of type IV transporter system, conserved regionVirB4, T4SS component 
33Dd586_26673001295..3001999 [+], 705type IV secretion system family proteinVirB5, T4SS component 
34Dd586_26683002011..3002235 [+], 225conserved hypothetical proteinMagB05, T4SS component 
35Dd586_26693002246..3003310 [+], 1065TrbL/VirB6 plasmid conjugal transfer proteinVirB6, T4SS component 
36Dd586_26703003394..3003531 [+], 138conserved hypothetical proteinVirB7, T4SS component 
37Dd586_26713003524..3004207 [+], 684VirB8 family proteinVirB8, T4SS component 
38Dd586_26723004207..3005112 [+], 906P-type conjugative transfer protein VirB9VirB9, T4SS component 
39Dd586_26733005132..3006373 [+], 1242conjugation TrbI family proteinVirB10, T4SS component 
40Dd586_26743006366..3006752 [+], 387hypothetical protein
41Dd586_26753006683..3007690 [-], 1008conserved hypothetical protein
42Dd586_26763007728..3008747 [+], 1020P-type DNA transfer ATPase VirB11VirB11, T4SS component 
43Dd586_26773008744..3009142 [+], 399conserved hypothetical protein
44Dd586_26783009188..3009490 [+], 303KikA from plasmid origin; putative exported protein
45Dd586_26793009540..3009845 [+], 306conserved hypothetical protein
46Dd586_26813010556..3012415 [+], 1860putative MobB mobilization proteinVirD4, T4SS component 
47Dd586_26823012425..3013171 [+], 747mobilization protein
48Dd586_26833013367..3014314 [-], 948domain of unknown function DUF1738
49Dd586_26843014599..3016797 [-], 2199helicase domain protein
50Dd586_26853016841..3018469 [-], 1629conserved hypothetical protein
51Dd586_26863019385..3020161 [-], 777short-chain dehydrogenase/reductase SDR
52Dd586_26873020192..3020485 [-], 294Stress responsive alpha-beta barrel domain protein
53Dd586_26883020496..3021557 [-], 1062Alcohol dehydrogenase zinc-binding domain protein
54Dd586_26893021707..3022666 [+], 960transcriptional regulator, LysR family
55Dd586_26903023663..3024925 [+], 1263glycosyl transferase family 28
56Dd586_26913025156..3026919 [+], 1764gamma-glutamyltransferase
 
flank Flanking regions
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins52Fasta
Identified as part of this study from CP001836