ICEberg
I. Information of ICE
ICEberg ID12
Name ICEVchBan5 This ICE is derived from experimental literature
FamilySXT/R391
OrganismVibrio cholerae O1 Ban5
Size (bp)102122
GC content [Genome] (%)47.28
Insertion siteprfC
FunctionAntibiotic resistance genes: floR, strBA, sul2, dfrA1; glyoxoylase abx resistance
Species that ICE can be transferred to-
Nucleotide SequenceGQ463140 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..102122 
Putative oriT region coordinates: 5756..5862;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 46066..48216; Locus tag: ICEVCHBAN5_0042;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEVchBan5 is not available.



The graph information of ICEVchBan5 components from GQ463140
Complete gene list of ICEVchBan5 from GQ463140
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1ICEVCHBAN5_0001415..603 [+], 189conserved domain protein
2ICEVCHBAN5_0002749..2767 [+], 2019putative DNA mismatch repair protein
3ICEVCHBAN5_00032897..4138 [-], 1242integraseIntegrase 
4ICEVCHBAN5_00044140..4313 [-], 174conserved hypothetical protein
5ICEVCHBAN5_00054412..5386 [-], 975conserved hypothetical protein
6ICEVCHBAN5_00065482..5649 [+], 168hypothetical protein
7ICEVCHBAN5_00075694..5828 [+], 135hypothetical protein
8ICEVCHBAN5_00085851..6294 [+], 444conserved hypothetical protein
9ICEVCHBAN5_00096305..7477 [-], 1173protein UmuC
10ICEVCHBAN5_00107761..8354 [+], 594transposase, IS3 family, interruption
11ICEVCHBAN5_00118468..11446 [+], 2979transposase
12ICEVCHBAN5_001211864..13357 [+], 1494iscr2 transposase
13ICEVCHBAN5_001313388..14272 [+], 885conserved hypothetical protein
14ICEVCHBAN5_001414489..15703 [+], 1215florfenicol/chloramphenicol resistance protein
15ICEVCHBAN5_001515758..16036 [+], 279truncated helix-turn-helix multiple antibiotic resistance protein
16ICEVCHBAN5_001616148..17641 [+], 1494iscr2 transposase
17ICEVCHBAN5_001717672..18556 [+], 885conserved hypothetical protein
18ICEVCHBAN5_001818773..19987 [+], 1215florfenicol/chloramphenicol resistance proteinAR 
19ICEVCHBAN5_001920042..20320 [+], 279truncated helix-turn-helix multiple antibiotic resistance protein
20ICEVCHBAN5_002120432..20971 [+], 540truncated transposase
21ICEVCHBAN5_002020943..21773 [-], 831streptomycin resistance protein BAR 
22ICEVCHBAN5_002221779..22582 [-], 804streptomycin 3''-kinaseAR 
23folP22643..23458 [-], 816dihydropteroate synthaseAR 
24ICEVCHBAN5_002523929..25281 [+], 1353TnpA
25ICEVCHBAN5_002425273..26484 [-], 1212transposase, Mutator family
26ICEVCHBAN5_002626542..27045 [-], 504MutL protein
27ICEVCHBAN5_002727198..27467 [-], 270ultraviolet light resistance protein B
28ICEVCHBAN5_002827475..27924 [-], 450protein UmuD
29ICEVCHBAN5_002928043..28180 [+], 138hypothetical protein
30ICEVCHBAN5_003028564..29469 [+], 906exonuclease, RNase T and DNA polymerase III
31ICEVCHBAN5_003129557..29856 [+], 300conserved hypothetical protein
32ICEVCHBAN5_003230174..31094 [+], 921conserved hypothetical protein
33ICEVCHBAN5_003331112..31912 [+], 801hypothetical protein
34ICEVCHBAN5_003431896..32444 [+], 549conserved hypothetical protein
35ICEVCHBAN5_003532457..36146 [+], 3690conserved hypothetical protein
36ICEVCHBAN5_003636151..39891 [+], 3741conserved hypothetical protein
37ICEVCHBAN5_003739904..42207 [+], 2304PglZ domain family
38ICEVCHBAN5_003842246..44297 [+], 2052conserved hypothetical protein
39ICEVCHBAN5_003944324..45094 [+], 771conserved hypothetical protein
40ICEVCHBAN5_004145129..45944 [+], 816conserved hypothetical protein
41ICEVCHBAN5_004045921..46043 [-], 123hypothetical protein
42ICEVCHBAN5_004246066..48216 [+], 2151conjugative relaxaseRelaxase, MOBH Family
43ICEVCHBAN5_004348265..50085 [+], 1821conjugative coupling factorTraD_F, T4SS component 
44ICEVCHBAN5_004450095..50655 [+], 561conserved hypothetical protein
45ICEVCHBAN5_004550642..51277 [+], 636putative conjugation coupling factor
46ICEVCHBAN5_004651304..51891 [-], 588conserved hypothetical protein
47traL52180..52461 [+], 282type IV conjugative transfer system protein TraLTraL_F, T4SS component 
48ICEVCHBAN5_004852458..53084 [+], 627sex pilus assemblyTraE_F, T4SS component 
49ICEVCHBAN5_004953068..53964 [+], 897TraKTraK_F, T4SS component 
50ICEVCHBAN5_005053967..55256 [+], 1290sex pilus assemblyTraB_F, T4SS component 
51ICEVCHBAN5_005155331..55903 [+], 573sex pilus assemblyTraV_F, T4SS component 
52ICEVCHBAN5_005255900..56286 [+], 387TraATraA_F, T4SS component 
53ICEVCHBAN5_005356507..57298 [+], 792conserved hypothetical protein
54ICEVCHBAN5_005457291..58229 [+], 939ync
55ICEVCHBAN5_005558361..59053 [+], 693DsbCTrbB_I, T4SS component 
56traC59053..61452 [+], 2400type-IV secretion system protein TraCTraC_F, T4SS component 
57ICEVCHBAN5_005761445..61792 [+], 348conserved hypothetical protein
58ICEVCHBAN5_005861776..62288 [+], 513conjugation signal peptidaseTraF, T4SS component 
59ICEVCHBAN5_006063407..64435 [+], 1029sex pilus assemblyTraU_F, T4SS component 
60ICEVCHBAN5_006164438..68130 [+], 3693mating pair stabilizationTraN_F, T4SS component 
61ICEVCHBAN5_006268221..69837 [-], 1617conserved hypothetical protein
62ICEVCHBAN5_006369917..70672 [-], 756IstB domain protein ATP-binding proteinTrbB, T4SS component 
63ICEVCHBAN5_006470662..72170 [-], 1509integrase, catalytic region
64ICEVCHBAN5_006572269..73348 [-], 1080SMC domain protein
65ICEVCHBAN5_006673516..74199 [-], 684endonuclease-1 (Endonuclease I) (Endo I)
66ICEVCHBAN5_006774308..74910 [-], 603conserved hypothetical protein
67ICEVCHBAN5_006875278..75604 [+], 327conserved hypothetical protein
68ICEVCHBAN5_006975620..76039 [+], 420single-strand binding protein family
69ICEVCHBAN5_007076119..76937 [+], 819phage recombination protein Bet
70ICEVCHBAN5_007177019..77162 [+], 144hypothetical protein
71ICEVCHBAN5_007277223..78239 [+], 1017YqaJ viral recombinase family
72ICEVCHBAN5_007478332..79408 [+], 1077ATPase associated with various cellular activities, AAA_5
73ICEVCHBAN5_007378428..78550 [-], 123hypothetical protein
74ICEVCHBAN5_007579408..80175 [+], 768conserved hypothetical protein
75ICEVCHBAN5_007680274..81227 [+], 954conserved hypothetical protein
76ICEVCHBAN5_007781289..81729 [+], 441conserved hypothetical protein
77ICEVCHBAN5_007881799..83454 [+], 1656von Willebrand factor, type A
78radC83539..84036 [+], 498DNA repair protein RadC
79ICEVCHBAN5_008084036..84377 [+], 342conserved hypothetical protein
80ICEVCHBAN5_008184468..85541 [+], 1074phage P4 alpha, zinc-binding domain protein
81ICEVCHBAN5_008285631..86338 [+], 708conserved hypothetical protein
82ICEVCHBAN5_008486610..87014 [+], 405glyoxalase/bleomycin resistance protein/dioxygenase
83ICEVCHBAN5_008387011..87712 [-], 702conserved hypothetical protein
84ICEVCHBAN5_008587812..88174 [-], 363conserved hypothetical protein
85ICEVCHBAN5_008688245..88655 [-], 411membrane associated protein containing xre-family DNA-binding HTH domain
86ICEVCHBAN5_008788853..89278 [-], 426conserved hypothetical protein
87folA89383..89856 [-], 474dihydrofolate reductaseAR 
88ICEVCHBAN5_008991074..91214 [-], 141hypothetical protein
89ICEVCHBAN5_009191360..92304 [+], 945conserved hypothetical proteinTraF_F, T4SS component 
90ICEVCHBAN5_009292307..93695 [+], 1389sex pilus assemblyTraH_F, T4SS component 
91ICEVCHBAN5_009393699..97268 [+], 3570sex pilus assemblyTraG_F, T4SS component 
92ICEVCHBAN5_009497301..97732 [-], 432EexR1
93ICEVCHBAN5_009597790..98323 [-], 534transcriptional activator
94ICEVCHBAN5_009698320..98619 [-], 300SetD
95ICEVCHBAN5_009798616..99164 [-], 549lytic transglycosylase, catalyticOrf169_F, T4SS component 
96ICEVCHBAN5_009899151..99813 [-], 663conserved hypothetical protein
97ICEVCHBAN5_009999800..100669 [-], 870conserved hypothetical protein
98ICEVCHBAN5_0100100725..100976 [-], 252SetQ
99ICEVCHBAN5_0101101094..101741 [+], 648HTH-type transcriptional regulator for conjugative element R391
100ICEVCHBAN5_0102101998..102122 [+], 125peptide termination factor
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins100Fasta
(1) Wozniak RA; Fouts DE; Spagnoletti M; Colombo MM; Ceccarelli D; Garriss G; Dery C; Burrus V; Waldor MK (2009). Comparative ICE genomics: insights into the evolution of the SXT/R391 family of ICEs. PLoS Genet. 5(12):e1000786. [PudMed:20041216] in_silico
(2) Marrero J; Waldor MK (2007). The SXT/R391 family of integrative conjugative elements is composed of two exclusion groups. J Bacteriol. 189(8):3302-5. [PudMed:17307849] experimental
 
experimental experimental literature
in_silico in silico analysis literature