ICEberg
I. Information of ICE
ICEberg ID1077
Name ICEXTD This ICE is derived from experimental literature
FamilyICEclc
OrganismAzoarcus sp. CIB
Size (bp)173,798
GC content [Genome] (%)-
Insertion sitetRNAGly(TTCGATTCCCATCGCCCGCTCCA)
Functionxylene and toluene degradation
Species that ICE can be transferred toAzoarcus sp. CIBTRif
Nucleotide SequenceCP011072 (complete ICE sequence in this genome)
Replicon-
Genome coordinates4894159..5067957 
Putative oriT region -
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of ICEXTD is not available.



The graph information of ICEXTD components from CP011072
Complete gene list of ICEXTD from CP011072
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1AzCIB_43924890129..4891940 [-], 1812protease IV
2AzCIB_43934892062..4892823 [-], 762tRNA (guanine-N(7))-methyltransferase
3AzCIB_43944892936..4893721 [-], 786thiazole synthase
4AzCIB_43954893777..4894043 [-], 267thiamine biosynthesis protein
5AzCIB_43964894405..4896273 [+], 1869integrase family protein
6AzCIB_43974896359..4897000 [-], 642LysR family transcriptional regulator
7AzCIB_43984897215..4897397 [+], 183hypothetical protein
8AzCIB_43994897425..4898324 [-], 900LysR family transcriptional regulator
9AzCIB_44004898499..4899527 [+], 1029transposase
10AzCIB_44014899640..4900998 [+], 1359IS4 family transposase
11AzCIB_44024901506..4901814 [+], 309IS66 family element, orf1
12AzCIB_44034901877..4902158 [+], 282IS66 Orf2 family protein
13AzCIB_44044902225..4903754 [+], 1530transposase IS66
14AzCIB_44054903757..4904341 [+], 585hypothetical protein
15AzCIB_44064904635..4905198 [-], 5642-hydroxy-6-oxo-7-methylocta-2,4-dienoate hydrolase
16AzCIB_44074905559..4906935 [-], 1377outer membrane protein
17AzCIB_44084907118..4907975 [-], 858alpha/beta hydrolase fold
18AzCIB_44094908026..4909060 [-], 10354-hydroxy-2-ketovalerate aldolase
19AzCIB_44104909077..4910024 [-], 948acetaldehyde dehydrogenase
20AzCIB_44114910219..4911004 [-], 7862-hydroxypenta-2,4-dienoate hydratase
21AzCIB_44124911173..4912108 [-], 9363-isopropylcatechol-2,3-dioxygenase
22AzCIB_44134912135..4913001 [-], 867TodD
23AzCIB_44144913027..4914268 [-], 1242TodA
24AzCIB_44154914265..4914597 [-], 333TodB
25AzCIB_44164914636..4915151 [-], 516putative membrane protein
26AzCIB_44174915154..4915333 [-], 180TodC2
27AzCIB_44184915815..4917191 [-], 1377Biphenyl dioxygenase subunit alpha
28AzCIB_44194917265..4918011 [-], 747GntR family transcriptional regulator
29AzCIB_44234918993..4919295 [-], 303hypothetical protein
30AzCIB_44244919484..4919675 [+], 192phage-related integrase
31AzCIB_44264920059..4920403 [-], 345hypothetical protein
32AzCIB_44274920548..4921333 [+], 786hypothetical protein
33AzCIB_44284921392..4922204 [+], 813extradiol ring-cleavage dioxygenase, class III enzyme, subunit B
34AzCIB_44294921433..4922290 [+], 858Catalytic LigB subunit of aromatic ring-opening dioxygenase superfamily
35AzCIB_44304922338..4922493 [+], 156hypothetical protein
36AzCIB_44314922504..4923595 [+], 1092NADH:flavin oxidoreductase/NADH oxidase
37AzCIB_44324923724..4924830 [-], 1107ABC-2 type transporter
38AzCIB_44334924869..4926023 [-], 1155ABC-2 type transporter
39AzCIB_44344926020..4927981 [-], 1962Monosaccharide-transporting ATPase
40AzCIB_44354927960..4929069 [-], 1110secretion protein HlyD family protein
41AzCIB_44364929083..4930387 [-], 1305outer membrane efflux protein
42AzCIB_44374930384..4933665 [-], 3282acriflavin resistance protein
43AzCIB_44384933665..4934744 [-], 1080secretion protein HlyD
44AzCIB_44394935011..4937479 [-], 2469glycosyltransferase 28 domain-containing protein
45AzCIB_44404937542..4938303 [-], 762hypothetical protein
46AzCIB_44414938314..4939261 [-], 948patatin
47AzCIB_44424939264..4940934 [-], 1671ABC transporter
48AzCIB_44434940934..4941794 [-], 861hypothetical protein
49AzCIB_44444941884..4942510 [-], 627TetR family transcriptional regulator
50AzCIB_44454942625..4942738 [+], 114dinitrogenase reductase activating glycohydrolase
51AzCIB_44464943189..4944217 [+], 1029putative transposase
52AzCIB_44474944532..4946343 [-], 1812hypothetical protein
53AzCIB_44484946590..4946976 [+], 387AbrB family transcriptional regulator
54AzCIB_44494946976..4947440 [+], 465hypothetical protein
55AzCIB_44504947589..4947828 [+], 240hypothetical protein
56AzCIB_44514947854..4949383 [-], 1530hypothetical protein
57AzCIB_44524949399..4949755 [-], 357hypothetical protein
58AzCIB_44534949752..4951152 [-], 1401hypothetical protein
59AzCIB_44544951163..4952113 [-], 951hypothetical protein
60AzCIB_44554952110..4952562 [-], 453hypothetical protein
61AzCIB_44564952731..4953225 [-], 495RadC family DNA repair protein
62AzCIB_44574953420..4953965 [-], 546hypothetical protein
63AzCIB_44584954243..4957113 [-], 2871hypothetical protein
64AzCIB_44594957113..4957514 [-], 402hypothetical protein
65AzCIB_44604957528..4958985 [-], 1458hypothetical protein
66AzCIB_44614958975..4959892 [-], 918hypothetical protein
67AzCIB_44624959889..4960578 [-], 690hypothetical protein
68AzCIB_44634960575..4960964 [-], 390hypothetical protein
69AzCIB_44644961025..4961390 [-], 366hypothetical protein
70AzCIB_44654961414..4961653 [-], 240integrating conjugative element protein, PFL_4701 family
71AzCIB_44664961650..4962015 [-], 366hypothetical protein
72AzCIB_44674961998..4962207 [+], 210hypothetical protein
73AzCIB_44684962192..4963028 [-], 837transposase
74AzCIB_44694963077..4963220 [-], 144transposase
75AzCIB_44714963831..4965012 [-], 1182drug resistance transporter, Bcr/CflA subfamily
76AzCIB_44724965108..4965368 [+], 261TnpA
77AzCIB_44734965687..4965908 [+], 222TnpA
78AzCIB_44744966060..4967001 [-], 942putative enoyl-CoA Hydratase
79AzCIB_44754966887..4967897 [-], 1011putative acyl-CoA dehydrogenase
80AzCIB_44764967910..4969061 [-], 1152putative acyl-CoA dehydrogenase
81AzCIB_44774969058..4970371 [-], 1314putative CoA-transferase
82AzCIB_44784970853..4971989 [-], 1137putative methyl-glutaryl-CoA dehydrogenase
83AzCIB_44794972148..4973173 [-], 1026putative 2-oxoglutarate:ferredoxin oxidoreductase beta subunit
84AzCIB_44804973214..4975121 [-], 1908putative 2-oxoglutarate:ferredoxin oxidoreductase alfa subunit
85AzCIB_44814975324..4975563 [-], 240ferredoxin
86AzCIB_44834976197..4976967 [-], 771methyl-cyclohex-1,5-diene-1-carbonyl-CoA hydratase
87AzCIB_44844976981..4978117 [-], 1137putative methyl-6-ketocyclohex-1-ene-1-carbonyl-CoA hydrolase
88AzCIB_44854978142..4979209 [-], 1068putative methyl-6-hydroxycyclohex-1-ene-1-carbonyl-CoA dehydrogenase
89AzCIB_44864979295..4980158 [-], 864putative hydroxyacyl-CoA dehydrogenase
90AzCIB_44874980171..4980941 [-], 771putative enoyl-CoA hydratase
91AzCIB_44884980952..4982148 [-], 1197putative thiolase
92AzCIB_44894982162..4983004 [-], 843putative amidohydrolase 2
93AzCIB_44904983626..4984447 [-], 8223-methylbenzoyl-CoA reductase delta subunit
94AzCIB_44914984451..4985260 [-], 8103-methylbenzoyl-CoA reductase alfa subunit
95AzCIB_44924985282..4986448 [-], 11673-methylbenzoyl-CoA reductase gamma subunit
96AzCIB_44934986469..4987806 [-], 13383-methylbenzoyl-CoA reductase beta subunit
97AzCIB_44944988299..4989543 [+], 1245putative 3-methylbenzoate transporter periplasmic subunit
98AzCIB_44954989648..4990520 [+], 873putative 3-methylbenzoate transporter permease
99AzCIB_44964990501..4991511 [+], 1011putative 3-methylbenzoate transporter permease
100AzCIB_44974991504..4992280 [+], 777putative 3-methylbenzoate transporter ATPase
101AzCIB_44984992342..4992974 [+], 633putative 3-methylbenzoate transporter ATPase
102AzCIB_44994993206..4994786 [+], 15813-methylbenzoate-CoA ligase
103AzCIB_45004994995..4995639 [-], 645TetR-family transcriptional regulator
104AzCIB_45014996073..4996729 [-], 657response regulator
105AzCIB_45024996799..4998436 [-], 1638Sensor protein TdiS
106AzCIB_45034998742..4999740 [+], 999BssD
107AzCIB_45044999744..4999941 [+], 198benzylsuccinate synthase gamma subunit
108AzCIB_45054999965..5002559 [+], 2595Benzylsuccinate synthase alpha subunit
109AzCIB_45065002636..5002866 [+], 231beta subunit of benzylsuccinate synthase
110AzCIB_45075002941..5003774 [+], 834BssE
111AzCIB_45085003783..5005525 [+], 1743BssF
112AzCIB_45095005522..5006094 [+], 573BssG
113AzCIB_45105006091..5006372 [+], 282MoaD family protein
114AzCIB_45115006386..5006910 [+], 525hypothetical protein
115AzCIB_45125006919..5007518 [+], 600BssI
116AzCIB_45135007515..5008438 [+], 924BssJ
117AzCIB_45145008462..5009406 [+], 945BssK
118AzCIB_45155009403..5010959 [+], 1557BssL
119AzCIB_45165011028..5014177 [-], 3150Tol
120AzCIB_45175014409..5015038 [-], 630BbsI
121AzCIB_45185015101..5015871 [-], 771BbsH
122AzCIB_45195015907..5017127 [-], 1221(R)-benzylsuccinyl-CoA dehydrogenase
123AzCIB_45205017180..5017464 [-], 285BbsJ
124AzCIB_45215017544..5018734 [-], 1191Succinyl-CoA:(R)-benzylsuccinate CoA-transferase subunit BbsF
125AzCIB_45225018757..5019989 [-], 1233Succinyl-CoA:(R)-benzylsuccinate CoA-transferase subunit BbsE
126AzCIB_45235020032..5020778 [-], 747BbsD
127AzCIB_45245020793..5021545 [-], 753BbsC
128AzCIB_45255021559..5022728 [-], 1170BbsB
129AzCIB_45265022749..5023183 [-], 435BbsA
130AzCIB_45275023448..5024761 [-], 1314OrfB
131AzCIB_45285024789..5026834 [-], 2046cox2 cytochrome oxidase subunit 2
132AzCIB_45295026902..5029328 [-], 2427hypothetical protein
133AzCIB_45305029339..5030319 [-], 981hypothetical protein
134AzCIB_45315030603..5031961 [-], 1359IS4 family transposase
135AzCIB_45335032361..5032819 [-], 459IS4 family transposase
136AzCIB_45345033111..5033329 [-], 219hypothetical protein
137AzCIB_45355033425..5034174 [-], 750membrane protein
138AzCIB_45365034171..5036327 [-], 2157hypothetical protein
139AzCIB_45375036352..5036888 [-], 537hypothetical protein
140AzCIB_45385036885..5037472 [-], 588lytic transglycosylase
141AzCIB_45395037457..5038182 [-], 726integrating conjugative element protein, PFL_4693 family
142AzCIB_45405038192..5038851 [-], 660hypothetical protein
143AzCIB_45415038848..5039267 [-], 420hypothetical protein
144AzCIB_45425039770..5040084 [-], 315integration host factor beta-subunit (ihf-beta)
145AzCIB_45435040250..5042523 [-], 2274hypothetical protein
146AzCIB_45445042622..5042927 [-], 306hypothetical protein
147AzCIB_45455043029..5044138 [-], 1110hypothetical protein
148AzCIB_45465044206..5044862 [-], 657hypothetical protein
149AzCIB_45475045528..5046697 [-], 1170patatin
150AzCIB_45485046694..5048979 [-], 2286hesA/moeB/thiF type protein
151AzCIB_45495048967..5050133 [-], 1167hypothetical protein
152AzCIB_45505050329..5051156 [-], 828hypothetical protein
153AzCIB_45515051246..5051851 [-], 606hypothetical protein
154AzCIB_45525051906..5052460 [-], 555hypothetical protein
155AzCIB_45535052447..5052614 [+], 168hypothetical protein
156AzCIB_45545053012..5053470 [+], 459histone-like nucleoid-structuring protein
157AzCIB_45555053551..5053916 [-], 366hypothetical protein
158AzCIB_45565053982..5054335 [-], 354hypothetical protein
159AzCIB_45575054896..5055288 [-], 393hypothetical protein
160AzCIB_45585055313..5055459 [-], 147hypothetical protein
161AzCIB_45595055803..5056105 [+], 303hypothetical protein
162AzCIB_45605055905..5056132 [-], 228hypothetical protein
163AzCIB_45615056125..5056286 [-], 162hypothetical protein
164AzCIB_45625056354..5058369 [-], 2016DNA topoisomerase III
165AzCIB_45635058655..5059038 [-], 384ssDNA-binding protein
166AzCIB_45645059035..5059433 [-], 399hypothetical protein
167AzCIB_45655059580..5060347 [-], 768hypothetical protein
168AzCIB_45665060548..5061288 [-], 741hypothetical protein
169AzCIB_45675061584..5062786 [-], 1203hypothetical protein
170AzCIB_45685062790..5063350 [-], 561hypothetical protein
171AzCIB_45695063366..5065057 [-], 1692hypothetical protein
172AzCIB_45705065050..5065307 [-], 258hypothetical protein
173AzCIB_45715065291..5066169 [-], 879chromosome partitioning protein
174AzCIB_45725066211..5066426 [-], 216phage transcriptional regulator, AlpA
175AzCIB_45735066548..5067153 [-], 606hypothetical protein
176AzCIB_45745068018..5068548 [-], 531Superoxide dismutase (Cu-Zn)
177AzCIB_45755068675..5069175 [-], 501nitrilotriacetate monooxygenase
178AzCIB_45765069320..5070414 [+], 1095A/G-specific DNA glycosylase
179AzCIB_45775070532..5071164 [-], 633ATP-dependent protease La, LON domain-containing protein
180AzCIB_45785071164..5071796 [-], 6333-octaprenyl-4-hydroxybenzoate carboxy-lyase
 
flank Flanking regions

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins171Fasta
(1) Zamarro MT; Martin-Moldes Z; Diaz E (2016). The ICEXTD of Azoarcus sp. CIB, an integrative and conjugative element with aerobic and anaerobic catabolic properties. Environ Microbiol. 18(12):5018-5031. [PudMed:27450529] experimental
(2) Martin-Moldes Z; Zamarro MT; Del Cerro C; Valencia A; Gomez MJ; Arcas A; Udaondo Z; Garcia JL; Nogales J; Carmona M; Diaz E (2015). Whole-genome analysis of Azoarcus sp. strain CIB provides genetic insights to its different lifestyles and predicts novel metabolic features. Syst Appl Microbiol. 38(7):462-71. [PudMed:26259823] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature