ICEberg
I. Information of ICE
ICEberg ID1069
Name ICEVchNig1 This ICE is derived from experimental literature
FamilySXT/R391
OrganismVibrio cholerae O1 VC833
Size (bp)97043
GC content [Genome] (%)46.79
Insertion site-
FunctionAntibiotic resistance genes: floR, strAB, sul2, dfrA1
Species that ICE can be transferred to-
Nucleotide SequenceKC886258 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates528..97570 
Putative oriT region coordinates: 5869..5975;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of ICEVchNig1 is not available.



The graph information of ICEVchNig1 components from KC886258
Complete gene list of ICEVchNig1 from KC886258
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1K531_00005528..716 [+], 189DNA-binding protein
2K531_00010943..2880 [+], 1938hypothetical protein
3K531_000153010..4251 [-], 1242phage Integrase
4K531_000204253..4522 [-], 270hypothetical protein
5K531_000254525..5499 [-], 975rod shape determination protein
6K531_000305595..5762 [+], 168hypothetical protein
7K531_000356418..7590 [-], 1173DNA polymerase V
8K531_000407874..8467 [+], 594transposase Tn3
9K531_000458581..11559 [+], 2979transposase Tn3 family protein
10K531_0005011674..11865 [+], 192RepA protein
11K531_0005511977..13470 [+], 1494InsA
12K531_0006013501..14385 [+], 885Type IV secretory pathway VirD2 component
13K531_0006514602..15816 [+], 1215FloRAR 
14K531_0007015844..16149 [+], 306putative transcriptional regulator protein
15K531_0007516261..16800 [+], 540TnpA
16K531_0008016772..17608 [-], 837streptomycin 3''-kinaseAR 
17K531_0008517608..18411 [-], 804StrAAR 
18K531_0009018472..19287 [-], 816dihydropteroate synthaseAR 
19K531_0009519758..21110 [+], 1353transposase Tn3 family protein
20K531_0010021102..22313 [-], 1212transposase mutator family protein
21K531_0010522371..22874 [-], 504MutL protein
22K531_0011023027..23296 [-], 270error-prone repair protein UmuC
23K531_0011523304..23753 [-], 450DNA polymerase V
24K531_0012023752..24009 [+], 258hypothetical protein
25K531_0012524393..25298 [+], 906DNA polymerase III subunit epsilon
26K531_0013025386..25685 [+], 300plasmid-related protein
27K531_0013526003..26923 [+], 921hypothetical protein
28K531_0014026941..27741 [+], 801hypothetical protein
29K531_0014527725..28273 [+], 549hypothetical protein
30K531_0015028286..31975 [+], 3690hypothetical protein
31K531_0015531980..35720 [+], 3741hypothetical protein
32K531_0016035733..38036 [+], 2304PglZ domain protein
33K531_0016538075..40126 [+], 2052ATP-dependent Lon protease
34K531_0017040153..40923 [+], 771hypothetical protein
35K531_0017540958..41773 [+], 816hypothetical protein
36K531_0018041895..44045 [+], 2151conjugal transfer pilus assembly protein TraI
37K531_0018544094..45914 [+], 1821conjugal transfer pilus assembly protein TraDTraD_F, T4SS component 
38K531_0019045924..46484 [+], 561plasmid-related protein
39K531_0019546471..47106 [+], 636plasmid-related protein
40K531_0020047133..47720 [-], 588hypothetical protein
41K531_0020547734..47973 [-], 240plasmid-related protein
42K531_0021048009..48290 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
43K531_0021548287..48913 [+], 627IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
44K531_0022048897..49793 [+], 897conjugal transfer pilus assembly protein TraKTraK_F, T4SS component 
45K531_0022549796..51085 [+], 1290conjugal transfer pilus assembly protein TraBTraB_F, T4SS component 
46K531_0023051160..51732 [+], 573Conjugative transfer protein TraVTraV_F, T4SS component 
47K531_0023551729..52115 [+], 387conjugal transfer pilus assembly protein TraATraA_F, T4SS component 
48K531_0024052294..53127 [+], 834Ynd
49K531_0024553120..54058 [+], 939plasmid-related protein
50K531_0025054190..54882 [+], 693thiol:disulfide interchange protein DsbCTrbB_I, T4SS component 
51K531_0025554882..57281 [+], 2400conjugal transfer ATP-binding protein TraCTraC_F, T4SS component 
52K531_0026057274..57621 [+], 348hypothetical protein
53K531_0026557605..58117 [+], 513conjugal transfer pilin signal peptidase TrbITraF, T4SS component 
54K531_0027058128..59252 [+], 1125conjugal transfer pilus assembly protein TraWTraW_F, T4SS component 
55K531_0027559236..60264 [+], 1029conjugal transfer pilus assembly protein TraUTraU_F, T4SS component 
56K531_0028060267..63959 [+], 3693conjugal transfer mating pair stabilization protein TraNTraN_F, T4SS component 
57K531_0028564050..65666 [-], 1617SMC domain protein
58K531_0029065746..66501 [-], 756IstB ATP binding domain-containing proteinTrbB, T4SS component 
59K531_0029566491..67999 [-], 1509integrase catalytic subunit
60K531_0030068098..69141 [-], 1044hypothetical protein
61K531_0030569345..70028 [-], 684deoxyribonuclease I
62K531_0031070137..70739 [-], 603plasmid-related protein
63K531_0031571107..71433 [+], 327hypothetical protein
64K531_0032071449..71868 [+], 420single-strand DNA-binding protein
65K531_0032571948..72766 [+], 819phage recombination protein
66K531_0033072848..72991 [+], 144hypothetical protein
67K531_0033573052..74068 [+], 1017endonuclease-like phage-related protein
68K531_0034074278..75237 [+], 960cobaltochelatase CobS
69K531_0034575237..76004 [+], 768hypothetical protein
70K531_0035076103..77056 [+], 954cobalamine biosynthesis protein
71K531_0035577118..77558 [+], 441hypothetical protein
72K531_0036077628..79283 [+], 1656hypothetical protein
73K531_0036579368..79865 [+], 498DNA repair protein RadC
74K531_0037079865..80206 [+], 342hypothetical protein
75K531_0037580297..81370 [+], 1074hypothetical protein
76K531_0038081460..82167 [+], 708hypothetical protein
77K531_0038582439..82843 [+], 405glyoxalase/bleomycin resistance protein/dioxygenase
78K531_0039082840..83541 [-], 702hypothetical protein
79K531_0039583641..84003 [-], 363hypothetical protein
80K531_0040084074..84484 [-], 411DNA-binding HTH domain-protein
81K531_0040584682..85107 [-], 426hypothetical protein
82K531_0041085212..85685 [-], 474dihydrofolate reductaseAR 
83K531_0041585973..86932 [+], 960integron integraseIntegrase 
84K531_0042087189..88133 [+], 945conjugal transfer pilus assembly protein TraFTraF_F, T4SS component 
85K531_0042588136..89524 [+], 1389conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
86K531_0043089528..93097 [+], 3570conjugal transfer mating pair stabilization protein TraGTraG_F, T4SS component 
87K531_0043593130..93561 [-], 432hypothetical protein
88K531_0044093619..94152 [-], 534flagellar transcriptional activator FlhC
89K531_0044594149..94448 [-], 300flagellar transcriptional activator FlhD
90K531_0045094445..94993 [-], 549lytic transglycosylase, catalyticOrf169_F, T4SS component 
91K531_0045594980..95642 [-], 663hypothetical protein
92K531_0046095629..96498 [-], 870hypothetical protein
93K531_0046596554..96805 [-], 252hypothetical protein
94K531_0047096923..97570 [+], 648HTH-type transcriptional regulator for conjugative element SXT
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins94Fasta
(1) Marin MA; Fonseca EL; Andrade BN; Cabral AC; Vicente AC (2014). Worldwide occurrence of integrative conjugative element encoding multidrug resistance determinants in epidemic Vibrio cholerae O1. PLoS One. 9(9):e108728. [PudMed:25265418]