ICEberg
I. Information of ICE
ICEberg ID1044
Name ICEValHN396 This is a predicted ICE derived from literature
FamilySXT/R391
OrganismVibrio alginolyticus HN396
Size (bp)86687
GC content [Genome] (%)46.49
Insertion sitetRNA-ser
Function-
Species that ICE can be transferred to-
Nucleotide SequenceKT072770 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..86687 
Putative oriT region coordinates: 3663..3769;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 27634..29784; Locus tag: ICEValHN396_019;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEValHN396 is not available.



The graph information of ICEValHN396 components from KT072770
Complete gene list of ICEValHN396 from KT072770
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1ICEValHN396_00115..134 [+], 120Hypothetical protein
2int421..1653 [+], 1233IntegraseIntegrase 
3xis1738..1929 [+], 192Recombination directionality factor, Xis
4s0022045..2317 [-], 273Hypothetical protein, S002
5s0032320..3294 [-], 975Rod shape determination protein,S003
6ICEValHN396_0063457..3582 [-], 126Hypothetical protein
7mobI3758..4201 [+], 444Hypothetical protein, MobI
8rumB4269..5480 [-], 1212Error-prone repair protein, RumB
9rumA5488..5937 [-], 450Error-prone repair protein, RumA
10s0246563..7468 [+], 906DNA polymerase III, S024
11ICEValHN396_0117841..9220 [+], 1380Transposase
12ICEValHN396_0129217..9366 [-], 150Hypothetical protein
13s0259352..9540 [+], 189Hypothetical protein,S025
14s0269859..10782 [+], 924Hypothetical protein, S026
15ICEValHN396_01510884..13772 [+], 2889ATP-dependent helicase
16ICEValHN396_01613775..18646 [+], 4872Type II restriction enzyme, methylase subunits
17ICEValHN396_01718823..25245 [+], 6423DEAD/DEAH box helicase
18ICEValHN396_01825251..27386 [+], 2136Putative DNA helicaseTraI_F, T4SS component 
19rraI27634..29784 [+], 2151Conjugative transfer protein, TraIRelaxase, MOBH Family
20traD29832..31667 [+], 1836Conjugative transfer protein, TraDTraD_F, T4SS component 
21ICEValHN396_02131677..32237 [+], 561Conjugative transfer protein, S091
22traJ32224..32859 [+], 636Conjugative transfer protein, TraJ
23ICEValHN396_02332997..34103 [+], 1107Fic family protein
24ICEValHN396_02434159..34293 [-], 135Hypothetical protein
25hipA34299..34595 [-], 297HigA protein
26traL34829..35110 [+], 282Conjugative transfer pilus assembly protein, TraLTraL_F, T4SS component 
27traE35119..35733 [+], 615Conjugative transfer pilus assembly protein, TraETraE_F, T4SS component 
28traK35717..36613 [+], 897Conjugative transfer pilus assembly protein, TraKTraK_F, T4SS component 
29traB36616..37905 [+], 1290Conjugative transfer pilus assembly protein, TraBTraB_F, T4SS component 
30traV37902..38552 [+], 651Conjugative transfer protein, TraVTraV_F, T4SS component 
31traA38549..38935 [+], 387Conjugative transfer protein, TraATraA_F, T4SS component 
32ICEValHN396_03238976..39482 [-], 507Acetyltransferase
33ICEValHN396_03339473..39739 [-], 267Hypothetical protein
34dsbC40109..40801 [+], 693Thiol:disulfide involved in conjugative transfer, dsbCTrbB_I, T4SS component 
35traC40802..43204 [+], 2403Conjugative transfer pilus assembly protein, TraCTraC_F, T4SS component 
36ICEValHN396_03643197..43544 [+], 348Conjugative transfer protein 345
37trhF43528..44040 [+], 513Conjugative signal peptidase, TrhFTraF, T4SS component 
38traW44051..45175 [+], 1125Conjugative transfer pilus assembly protein, TraWTraW_F, T4SS component 
39traU45159..46187 [+], 1029Conjugative transfer protein, TraUTraU_F, T4SS component 
40traN46190..49882 [+], 3693Conjugative transfer protein, TraNTraN_F, T4SS component 
41ICEValHN396_04150579..50818 [+], 240Hypothetical protein
42ICEValHN396_04250961..51554 [+], 594ATP-binding protein
43ICEValHN396_04351759..52163 [+], 405putative transcriptional regulator
44ICEValHN396_04452477..54027 [+], 1551Aerotaxis sensor receptor protein
45cheV54024..54950 [+], 927Chemotaxis protein, CheV
46ICEValHN396_04654964..56124 [+], 1161GGDEF family protein
47ICEValHN396_04756127..57416 [+], 1290Methyl-accepting chemotaxis protein
48ICEValHN396_04857537..58064 [-], 528Transposase
49s06358115..58702 [-], 588Hypothetical protein,S063
50s08959070..59414 [+], 345Hypothetical protein, S089
51ssb59411..59830 [+], 420Single-stranded DNA-binding protein, Ssb
52bet59910..60728 [+], 819Recombination protein, Bet
53orfZ60812..60955 [+], 144Hypothetical protein, OrfZ
54exo61016..62032 [+], 1017Recombination related exonuclease, Exo
55cobS62242..63201 [+], 960Aerobic cobaltochelatase, CobS
56s08863201..63968 [+], 768Hypothetical protein,S088
57s06864067..65020 [+], 954Cobalamine biosynthesis protein, S068
58s06965082..65522 [+], 441Hypothetical protein,S069
59s07065592..67247 [+], 1656Plasmid associated protein, S070
60radC67331..67828 [+], 498DNA repair protein, RadC
61s09267828..68169 [+], 342Hypothetical protein, S092
62s07268258..69325 [+], 1068Putative primase,S072
63s07369414..70121 [+], 708Hypothetical protein, S073
64ICEValHN396_06470277..70594 [-], 318putative Transposase
65recQ71022..73151 [+], 2130ATP-dependent DNA helicase, RecQ
66dprA73288..74631 [+], 1344DNA recombination-mediator protein A, DprA
67ICEValHN396_06774678..74812 [-], 135Hypothetical protein
68traF75055..75999 [+], 945Conjugative transfer pilus assembly protein, TraFTraF_F, T4SS component 
69traH76002..77390 [+], 1389Conjugative transfer pilus assembly protein, TraHTraH_F, T4SS component 
70traG77394..80963 [+], 3570Conjugative transfer protein, TraGTraG_F, T4SS component 
71eex80994..81449 [-], 456Exclusion system protein, Eex
72ICEValHN396_07281464..82558 [-], 1095DDE superfamily endonuclease
73setC82597..83115 [-], 519Transcriptional activator, SetC
74setD83108..83410 [-], 303Transcriptional activator, SetD
75ICEValHN396_07583407..83955 [-], 549LysM/invasin proteinOrf169_F, T4SS component 
76s08383942..84604 [-], 663Hypothetical protein, S083
77s08484591..85460 [-], 870Hypothetical protein, S084
78setQ85516..85767 [-], 252Hypothetical protein, SetQ
79setR85884..86531 [+], 648cI prophage repressor protein, setR
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins79Fasta
(1) Luo P; He X; Wang Y; Liu Q; Hu C (2016). Comparative genomic analysis of six new-found integrative conjugative elements (ICEs) in Vibrio alginolyticus. BMC Microbiol. 0.721527778. [PudMed:27145747]