ICEberg
I. Information of ICE
ICEberg ID1041
Name ICEValA056-2 This is a predicted ICE derived from literature
FamilySXT/R391
OrganismVibrio alginolyticus 103826
Size (bp)103826
GC content [Genome] (%)46.19
Insertion sitetRNA-ser
Function-
Species that ICE can be transferred to-
Nucleotide SequenceKR231689 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..103826 
Putative oriT region coordinates: 3664..3770;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGCTACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTTGGGGTTAATTGGATGGGGAA
Putative relaxase coordinates: 21059..23209; Locus tag: ICEValA056-2_019;  Family:  MOBH


II. ICE interaction with IME/CIME/

The interaction information of ICEValA056-2 is not available.



The graph information of ICEValA056-2 components from KR231689
Complete gene list of ICEValA056-2 from KR231689
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1int421..1653 [+], 1233phage integraseIntegrase 
2xis1738..1929 [+], 192recombination directionality factor Xis
3ICEValA056-2_0032045..2308 [-], 264hypothetical protein
4ICEValA056-2_0042320..3294 [-], 975rod shape determination protein
5ICEValA056-2_0053390..3512 [+], 123hypothetical protein
6mobI3759..4202 [+], 444MobI
7rumB4213..5481 [-], 1269error-prone lesion bypass DNA polymerase RumB
8rumA5489..5938 [-], 450error-prone repair protein RumA
9ICEValA056-2_0096572..7477 [+], 906hypothetical protein
10ICEValA056-2_0107712..9103 [+], 1392DNA polymerase III epsilon subunit-like protein
11ICEValA056-2_0119148..9429 [+], 282transposase
12ICEValA056-2_0129747..10700 [+], 954hypothetical protein
13ICEValA056-2_01310770..12335 [+], 1566hypothetical protein
14prrA12332..13546 [+], 1215type I restriction-modification system DNA-methyltransferase subunit M
15prrB13548..14723 [+], 1176type I restriction-modification system specificity subunit S
16prrC14716..17832 [+], 3117anticodon nuclease
17prrD17936..19195 [+], 1260type I restriction-modification system restriction subunit R
18ICEValA056-2_01819208..20941 [+], 1734hypothetical protein
19herA21059..23209 [+], 2151bipolar DNA helicase HerARelaxase, MOBH Family
20traI23257..25077 [+], 1821conjugative transfer protein TraITraD_F, T4SS component 
21traD25087..25647 [+], 561IncF plasmid conjugative transfer protein TraD
22ICEValA056-2_02225634..26269 [+], 636conjugative transfer protein 234
23traJ26407..27513 [+], 1107conjugative transfer protein TraJ
24ICEValA056-2_02427569..27703 [-], 135Fic family protein
25higA27715..28005 [-], 291HigA antitoxin protein
26traL28238..28519 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
27traE28516..29142 [+], 627IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
28traK29126..30022 [+], 897IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
29traB30025..31314 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraBTraB_F, T4SS component 
30traV31389..31961 [+], 573conjugative transfer protein TraVTraV_F, T4SS component 
31traA31958..32344 [+], 387conjugative transfer protein TraATraA_F, T4SS component 
32mosT32522..33355 [+], 834toxin protein MosT
33mosA33348..34286 [+], 939antitoxin protein MosA
34dsbC34418..35110 [+], 693disulfide isomeraseTrbB_I, T4SS component 
35traC35110..37509 [+], 2400IncF plasmid conjugative transfer pilus assembly protein TraCTraC_F, T4SS component 
36ICEValA056-2_03637588..38691 [-], 1104transposase
37ICEValA056-2_03738905..39168 [+], 264conjugative transfer protein 345
38trhF39152..39664 [+], 513conjugative signal peptidase TrhFTraF, T4SS component 
39traW39675..40799 [+], 1125IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
40traU40831..41811 [+], 981IncF plasmid conjugative transfer pilus assembly protein TraUTraU_F, T4SS component 
41traN41814..45506 [+], 3693IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
42ICEValA056-2_04245738..46070 [+], 333hypothetical protein
43ICEValA056-2_04346101..46790 [+], 690hypothetical protein
44ICEValA056-2_04446768..47034 [-], 267mobile element protein
45ICEValA056-2_04547106..47534 [+], 429mobile element protein
46ICEValA056-2_04647580..48479 [-], 900transposase
47ICEValA056-2_04748816..49013 [-], 198hypothetical protein
48ICEValA056-2_04849021..49134 [-], 114hypothetical protein
49ICEValA056-2_04949696..50964 [+], 1269high-affinity choline uptake protein BetT
50ICEValA056-2_05051160..52017 [-], 858hypothetical protein
51yrbG52095..52565 [-], 471inner membrane protein YrbG
52ICEValA056-2_05252699..53556 [+], 858mobile element protein
53ICEValA056-2_05353537..53662 [+], 126hypothetical protein
54ICEValA056-2_05453720..54100 [-], 381hypothetical protein
55ICEValA056-2_05554170..55474 [+], 1305retron-type RNA-directed DNA polymerase
56ICEValA056-2_05655507..56361 [-], 855mobile element protein
57ICEValA056-2_05756489..57820 [-], 1332mobile element protein
58ICEValA056-2_05857948..58550 [-], 603hypothetical protein
59ICEValA056-2_05958681..58794 [-], 114hypothetical protein
60ICEValA056-2_06058918..59244 [+], 327hypothetical protein
61ssb59260..59679 [+], 420single-stranded DNA-binding protein
62bet59759..60577 [+], 819recombination protein Bet
63ICEValA056-2_06360658..60801 [+], 144hypothetical protein
64exo160863..61870 [+], 1008recombination system exonuclease EXO
65exo261867..62883 [+], 1017recombination system exonuclease EXO
66cobS63093..64052 [+], 960aerobic cobaltochelatase CobS subunit
67ICEValA056-2_06764052..64819 [+], 768hypothetical protein
68ICEValA056-2_06864918..65871 [+], 954cobalamine biosynthesis protein
69ICEValA056-2_06965933..66373 [+], 441hypothetical protein
70ICEValA056-2_07066443..68098 [+], 1656plasmid associated protein
71radC68182..68679 [+], 498DNA repair protein RadC
72ICEValA056-2_07268679..69020 [+], 342hypothetical protein
73ICEValA056-2_07369111..70184 [+], 1074putative primase
74ICEValA056-2_07470274..70981 [+], 708hypothetical protein
75ICEValA056-2_07571138..71470 [+], 333hypothetical protein
76ICEValA056-2_07671567..72919 [-], 1353hypothetical protein
77ICEValA056-2_07773435..74229 [+], 795hypothetical protein
78ICEValA056-2_07874250..74840 [-], 591hypothetical protein
79ICEValA056-2_07974987..75418 [-], 432hypothetical protein
80radC75415..75888 [-], 474DNA repair protein RadC
81ICEValA056-2_08176034..76213 [+], 180putative transcriptional regulator
82ICEValA056-2_08276384..76659 [+], 276hypothetical protein
83dpiA76740..77420 [-], 681transcriptional regulatory DpiA
84dpiB77407..79062 [-], 1656sensor kinase DpiB
85ICEValA056-2_08579175..80476 [-], 1302oxaloacetate decarboxylase beta subunit
86ICEValA056-2_08680492..82303 [-], 1812oxaloacetate decarboxylase alpha subunit
87ICEValA056-2_08782315..82566 [-], 252oxaloacetate decarboxylase gamma subunit
88ICEValA056-2_08882635..83981 [-], 1347Na(+)citrate OH(-) antiporter
89ICEValA056-2_08984249..85301 [+], 1053[citrate [pro-3S]-lyase] ligase
90ICEValA056-2_09085271..85639 [+], 369citrate lyase gamma subunit
91ICEValA056-2_09185621..86511 [+], 891citrate lyase beta subunit
92ICEValA056-2_09286521..88038 [+], 1518citrate lyase alpha subunit
93ICEValA056-2_09388035..88571 [+], 537apo-citrate lyase phosphoribosyl-dephospho-CoA transferase
94ICEValA056-2_09488552..89511 [+], 9602-(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A synthase
95ICEValA056-2_09589530..90357 [+], 828hypothetical protein
96ICEValA056-2_09690774..92108 [+], 1335mobile element protein
97ICEValA056-2_09792127..92387 [+], 261mobile element protein
98ICEValA056-2_09892378..93040 [-], 663mobile element protein
99traF93302..94234 [+], 933IncF plasmid conjugative transfer pilus assembly protein TraFTraF_F, T4SS component 
100traH94237..95625 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
101traG95629..99198 [+], 3570IncF plasmid conjugative transfer protein TraGTraG_F, T4SS component 
102eexR99231..99662 [-], 432exclusion system protein EexR
103setC99720..100253 [-], 534transcriptional activator SetC
104setD100250..100549 [-], 300transcriptional activator SetD
105ICEValA056-2_105100546..101094 [-], 549soluble lytic murein transglycosylaseOrf169_F, T4SS component 
106ICEValA056-2_106101081..101743 [-], 663hypothetical protein
107ICEValA056-2_107101730..102599 [-], 870hypothetical protein
108ICEValA056-2_108102655..102906 [-], 252hypothetical protein
109setR103024..103671 [+], 648cI prophage repressor protein SetR
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins109Fasta
(1) Luo P; He X; Wang Y; Liu Q; Hu C (2016). Comparative genomic analysis of six new-found integrative conjugative elements (ICEs) in Vibrio alginolyticus. BMC Microbiol. 0.721527778. [PudMed:27145747]