ICEberg
I. Information of ICE
ICEberg ID1023
Name ICEPmiChn3 This is a predicted ICE derived from literature
FamilySXT/R391
OrganismProteus mirabilis JN28
Size (bp)55,195
GC content [Genome] (%)50.27
Insertion site-
FunctionAntibiotic resistance genes: floR, sul2, aac(3)-IV, aadA2, dfrA23, ereA
Species that ICE can be transferred to-
Nucleotide SequenceKY437727 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..55195 
Putative oriT region coordinates: 3990..4096;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of ICEPmiChn3 is not available.



The graph information of ICEPmiChn3 components from KY437727
Complete gene list of ICEPmiChn3 from KY437727
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1xis914..1114 [+], 201Xis
2int1131..2372 [-], 1242integrase
3-2374..2643 [-], 270unknown
4-2646..3620 [-], 975hypothetical protein
5rumB4539..5711 [-], 1173UV repair DNA polymerase
6tnp5995..6588 [+], 594putative transposase
7tnpA6702..9680 [+], 2979transposase
8tnpB10098..11591 [+], 1494putative transposase
9-11622..12506 [+], 885hypothetical protein
10floR12723..13937 [+], 1215florfenicol exporterAR 
11lysR13965..14270 [+], 306hypothetical protein
12rcr214382..15875 [+], 1494transposase Rcr2
13glmM16051..16353 [-], 303GlmM, phosphoglucosamine mutase,catalyzes the conversion of glucosamine-6-phosphate to glucosamine-1-phosphate
14sul216440..17255 [-], 816dihydropteroate synthase type IIAR 
15-17345..17914 [+], 570transposase
16-18001..18435 [+], 435transposition protein
17dmpK19155..19289 [-], 135phenol hydrolase assembly protein
18-20928..21680 [+], 753transposase
19hph22102..23127 [-], 1026Hph, firefly luciferase-hygromycin B phosphotransferase fusion protein, confers resistance to hygromycin
20aac(3)-IV23356..24159 [-], 804aminoglycoside N-acetyltransferaseAR 
21tnpA24246..24950 [+], 705transposase
22intI125350..26111 [-], 762IntI1Integrase 
23dfrA3226269..26742 [+], 474dihydrofolate reductaseAR 
24ereA26935..28155 [+], 1221erythromycin esterase type 1AR 
25aadA228252..29031 [+], 780aminoglycoside adenyltransferaseAR 
26ISPpu12 tnpA29211..30425 [-], 1215putative transposase TnpA
27lspA30522..31034 [-], 513putative lipoprotein signal peptidase LspA
28orf131038..31934 [-], 897putative cation-efflux family protein
29orf232030..32437 [+], 408putative MerR family regulator
30-32667..33269 [-], 603hypothetical protein
31ssb33978..34397 [+], 420single-stranded DNA binding protein
32bet34477..35295 [+], 819recombination protein, Bet
33exo35582..36598 [+], 1017recombination related exonuclease, Exo
34cobS36691..37767 [+], 1077aerobic cobaltochelatase CobS subunit
35-37767..38534 [+], 768hypothetical protein
36-38633..39586 [+], 954hypothetical protein
37-39648..40088 [+], 441hypothetical protein
38-40158..41813 [+], 1656hypothetical protein
39-41896..42393 [+], 498DNA repair protein RadC
40-42393..42734 [+], 342hypothetical protein
41-42826..43899 [+], 1074putative primase
42-43989..44693 [+], 705hypothetical protein
43traF44798..45730 [+], 933TraFTraF_F, T4SS component 
44traH45733..47121 [+], 1389TraHTraH_F, T4SS component 
45traG47125..50694 [+], 3570TraGTraG_F, T4SS component 
46eexS50727..51182 [-], 456EexS
47setC51216..51749 [-], 534transcriptional activator
48setD51746..52045 [-], 300transcriptional activator
49-52042..52590 [-], 549hypothetical proteinOrf169_F, T4SS component 
50-52577..52945 [-], 369hypothetical protein
51-53226..54095 [-], 870hypothetical protein
52-53226..53747 [-], 522hypothetical protein
53-54151..54402 [-], 252hypothetical protein
54setR54520..55167 [+], 648transcriptional repressor
55prfC55424..57013 [+], 1590peptide chain release factor 3
 
flank Flanking regions
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins54Fasta
(1) Bie L; Wu H; Wang XH; Wang M; Xu H (2017). Identification and characterization of new members of the SXT/R391 family of integrative and conjugative elements (ICEs) in Proteus mirabilis. Int J Antimicrob Agents. 50(2):242-246. [PudMed:28602701] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature