ICEberg
I. Information of ICE
ICEberg ID1017
Name ICEPmiCHN1586 This ICE is derived from experimental literature
FamilySXT/R391
OrganismProteus mirabilis 08MAS1586
Size (bp)99,355
GC content [Genome] (%)46.98
Insertion site-
FunctionResistance to ampicillin, azithromycin, chloramphenicol, ciprofloxacin, ampicillin-sulbactam, streptomycin, trimethoprim-sulfamethoxazole, sulfamethoxazole, tetracycline
Species that ICE can be transferred to-
Nucleotide SequenceKX243404 (complete ICE sequence in this GenBank file)
Replicon-
Coordinates1..99355 
Putative oriT region coordinates: 5884..5990;   oriTDB id:  200056
TATCGAGACGCCAAACAGTGATTGTGACGGCAGTTTTACGTTTGGCGTTTCGATCCAAAAGCCAAACGGA
TAGTGGTTTTGGCTTTAGGGGTTAATTGGATGGGGAA
Putative relaxase -


II. ICE interaction with IME/CIME/

The interaction information of ICEPmiCHN1586 is not available.



The graph information of ICEPmiCHN1586 components from KX243404
Complete gene list of ICEPmiCHN1586 from KX243404
#Gene Coordinates [+/-], size (bp) Product 
(GenBank annotation)
*Reannotation 
1-472..660 [+], 189hypothetical protein
2mutL1279..2895 [+], 1617DNA mismatch repair protein MutL
3int3025..4266 [-], 1242integraseIntegrase 
4-4268..4537 [-], 270hypothetical protein
5-4540..5514 [-], 975hypothetical protein
6-5589..5777 [+], 189hypothetical protein
7-5979..6422 [+], 444hypothetical protein
8rumB6433..7536 [-], 1104Error-prone, lesion bypass DNA polymerase V (UmuC)
9tnp7889..8482 [+], 594Transposase
10tnpA8596..11574 [+], 2979Transposase
11tnpB11992..13485 [+], 1494Transposase
12-13721..13840 [+], 120hypothetical protein
13dhfR13837..14343 [+], 507Dihydrofolate reductase
14-15954..16718 [+], 765hypothetical protein
15floR16935..18149 [+], 1215Bicyclomycin resistance proteinAR 
16-18177..18482 [+], 306LysR family transcriptional regulator
17tnpB18594..19133 [+], 540Transposase
18strB19105..19941 [-], 837streptomycin phosphotransferaseAR 
19strA19941..20507 [-], 567streptomycin phosphotransferase
20sul220805..21620 [-], 816Dihydropteroate synthaseAR 
21tnpA22091..23704 [+], 1614Transposase
22rumB24047..24316 [-], 270Error-prone, lesion bypass DNA polymerase V (UmuC)
23rumA24324..24773 [-], 450Error-prone repair protein UmuD
24-24772..25029 [+], 258hypothetical protein
25-25412..26317 [+], 906DNA polymerase III
26-26405..26704 [+], 300hypothetical protein
27-27022..27945 [+], 924hypothetical protein
28-28047..30935 [+], 2889putative ATP-dependent helicase
29-32626..35970 [+], 3345Type II restriction enzyme, methylase subunits
30-36163..42585 [+], 6423Helicase
31-42591..44726 [+], 2136putative DNA helicaseTraI_F, T4SS component 
32traI46958..47197 [+], 240Conjugative transfer protein TraI, relaxase
33traD47246..49066 [+], 1821IncF plasmid conjugative transfer protein TraDTraD_F, T4SS component 
34-49076..49636 [+], 561Conjugative transfer protein 234
35-49623..50258 [+], 636Conjugative transfer protein s043
36-50285..50872 [-], 588hypothetical protein
37traL51161..51442 [+], 282IncF plasmid conjugative transfer pilus assembly protein TraLTraL_F, T4SS component 
38traE51439..52065 [+], 627IncF plasmid conjugative transfer pilus assembly protein TraETraE_F, T4SS component 
39traK52049..52945 [+], 897IncF plasmid conjugative transfer pilus assembly protein TraKTraK_F, T4SS component 
40traB52948..54237 [+], 1290IncF plasmid conjugative transfer pilus assembly protein TraBTraB_F, T4SS component 
41traV54312..54884 [+], 573Conjugative transfer protein TraVTraV_F, T4SS component 
42traA54881..55267 [+], 387Conjugative transfer protein TraATraA_F, T4SS component 
43ynd55445..56278 [+], 834Ynd
44ync56271..57209 [+], 939Ync
45-57708..58112 [+], 405Thiol:disulfide involved in conjugative transferTrbB_I, T4SS component 
46traC58112..60511 [+], 2400IncF plasmid conjugative transfer pilus assembly protein TraCTraC_F, T4SS component 
47-60504..60851 [+], 348Conjugative transfer protein 345
48trhF60835..61347 [+], 513Conjugative signal peptidase TrhFTraF, T4SS component 
49traW61358..62482 [+], 1125IncF plasmid conjugative transfer pilus assembly protein TraWTraW_F, T4SS component 
50traU62514..63494 [+], 981IncF plasmid conjugative transfer pilus assembly protein TraUTraU_F, T4SS component 
51traN65336..67402 [+], 2067IncF plasmid conjugative transfer protein TraNTraN_F, T4SS component 
52-67644..67892 [+], 249hypothetical protein
53-68777..70258 [+], 1482putative GTPases, GTP1/OBG family
54-70278..70796 [+], 519hypothetical protein
55dns70861..71202 [-], 342Endonuclease I precursor
56-71717..72319 [-], 603hypothetical protein
57-72556..72687 [-], 132hypothetical protein
58ssb73095..73514 [+], 420Single-stranded DNA-binding protein
59bet73594..74412 [+], 819Recombination protein BET
60-74496..74639 [+], 144hypothetical protein
61-74794..75810 [+], 1017hypothetical protein
62-76020..76979 [+], 960Aerobic cobaltochelatase CobS subunit
63-76979..77746 [+], 768hypothetical protein
64-77845..78798 [+], 954Cobalamine biosynthesis protein
65-78860..79300 [+], 441hypothetical protein
66-79370..81025 [+], 1656Plasmid associated gene product
67-81109..81606 [+], 498DNA repair protein RadC
68-81606..81947 [+], 342hypothetical protein
69-82365..83207 [+], 843putative primase
70-83297..84004 [+], 708hypothetical protein
71-84165..84338 [+], 174hypothetical protein
72-84512..86476 [+], 1965putative ATP-dependent endonuclease of the OLD family
73prcA86473..88365 [+], 1893ATP-dependent DNA helicase pcrA
74traF88653..89597 [+], 945IncF plasmid conjugative transfer pilus assembly protein TraFTraF_F, T4SS component 
75traH89600..90988 [+], 1389IncF plasmid conjugative transfer pilus assembly protein TraHTraH_F, T4SS component 
76traG90992..94561 [+], 3570IncF plasmid conjugative transfer protein TraGTraG_F, T4SS component 
77eexS94594..95049 [-], 456EexS
78setC95083..95616 [-], 534Transcriptional activator
79setD95613..95912 [-], 300Transcriptional activator
80-95909..96457 [-], 549Soluble lytic murein transglycosylase and related regulatory proteinsOrf169_F, T4SS component 
81-96444..97106 [-], 663hypothetical protein
82-97093..97962 [-], 870hypothetical protein
83-98018..98269 [-], 252hypothetical protein
84setR98387..99034 [+], 648Putative cI prophage repressor protein
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer
virulence  Gene may be involved in adaptative function

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins84Fasta
(1) Li X; Du Y; Du P; Dai H; Fang Y; Li Z; Lv N; Zhu B; Kan B; Wang D (2016). SXT/R391 integrative and conjugative elements in Proteus species reveal abundant genetic diversity and multidrug resistance. Sci Rep. 6:37372. [PudMed:27892525] experimental in_silico
 
experimental experimental literature
in_silico in silico analysis literature